Regulog Mce2R - Nocardiaceae

Member of regulog collections
- By taxonomy - Nocardiaceae
- By TF family - GntR/Others
- By pathway - Fatty acid metabolism
Genome | Genes | Operons |
---|---|---|
Nocardia farcinica IFM 10152 | 3 | 2 |
Rhodococcus erythropolis PR4 | 2 | 1 |
Rhodococcus opacus B4 | 2 | 1 |
Rhodococcus sp. RHA1 | 2 | 1 |
Genes | Function | ||||
---|---|---|---|---|---|
CRON 1. | |||||
mce2R |
*2
Nocardia farcinica IFM 10152 Site: position = -54 score = 4.84458 sequence = CAAACTGGTCCAACCAGTTGA Gene: nfa16280: Transcriptional regulator, GntR family Site: position = -68 score = 4.65431 sequence = GCAATTGGTCTTACCACGATT Site: position = -53 score = 5.65713 sequence = ACGATTGGTCTTACCACTTGA Gene: nfa1630: Transcriptional regulator, GntR family |
*
Rhodococcus erythropolis PR4 Site: position = -52 score = 5.83614 sequence = CTAACTGGTCATACCACTTGA Gene: RER_01500: Transcriptional regulator, GntR family |
*
Rhodococcus opacus B4 Site: position = -53 score = 5.63599 sequence = CGCACTGGTAAGACCACTTGA Gene: ROP_07730: Transcriptional regulator, GntR family |
*
Rhodococcus sp. RHA1 Site: position = -48 score = 5.79739 sequence = TGCACTGGTAAGACCACTTGA Gene: RHA1_ro01046: Transcriptional regulator, GntR family |
Transcriptional regulator, GntR family |
fah |
Gene: nfa1620: Fatty acid hydroxylase FAH1P |
Gene: RER_01490: Fatty acid hydroxylase FAH1P |
Gene: ROP_07740: Fatty acid hydroxylase FAH1P |
Gene: RHA1_ro01047: Fatty acid hydroxylase FAH1P |
Fatty acid hydroxylase FAH1P |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |