Regulog TreR - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Trehalose utilization |
| Effector: | Trehalose-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By TF family - LacI
- By effector - Trehalose-6-phosphate
- By pathway - Trehalose utilization
| Genome | Genes | Operons |
|---|---|---|
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | 3 | 1 |
| Aeromonas salmonicida subsp. salmonicida A449 | 3 | 1 |
| Moritella sp. PE36 | ||
| Psychromonas ingrahamii 37 | 2 | 1 |
| Psychromonas sp. CNPT3 | ||
| Tolumonas auensis DSM 9187 | 2 | 1 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| treB |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -48 score = 7.3944 sequence = AAATGGGAACGTTCCCATTT Gene: AHA_3824: PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component (EC 2.7.1.69) |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -138 score = 7.3944 sequence = AAATGGGAACGTTCCCATTT Site: position = -92 score = 5.19678 sequence = AAATGGGAACGATACCAAAA Gene: ASA_0484: PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component (EC 2.7.1.69) |
|
*
Psychromonas ingrahamii 37 Site: position = -47 score = 5.65806 sequence = AATTGGGAGCGCTCCCATAA Site: position = -134 score = 6.49784 sequence = TAATGGGAGCATTCCCATTT Gene: Ping_0522: PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component (EC 2.7.1.69) |
|
*
Tolumonas auensis DSM 9187 Site: position = -75 score = 5.49563 sequence = AACTGGGAACGTTACCAACT Site: position = -121 score = 6.79669 sequence = AATTGGGAACGTTCCCTTTT Gene: Tola_0165: PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component (EC 2.7.1.69) |
PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component (EC 2.7.1.69) |
| treC |
Gene: AHA_3823: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Gene: ASA_0485: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
|
Gene: Ping_0523: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
|
Gene: Tola_0164: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
| maa |
Gene: AHA_3822: Putative maltose O-acetyltransferase |
Gene: ASA_0486: Putative maltose O-acetyltransferase |
|
|
|
Gene: Tola_1475: Putative maltose O-acetyltransferase |
Putative maltose O-acetyltransferase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |