Regulog VF_1255 - Vibrionales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Vibrionales
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Vibrio harveyi ATCC BAA-1116 | ||
| Vibrio angustum S14 | ||
| Vibrio cholerae O1 biovar eltor str. N16961 | ||
| Vibrio fischeri ES114 | 2 | 1 |
| Vibrio parahaemolyticus RIMD 2210633 | ||
| Photobacterium profundum SS9 | 2 | 1 |
| Vibrio salmonicida LFI1238 | 2 | 1 |
| Vibrio shilonii AK1 | 2 | 1 |
| Vibrio splendidus LGP32 | ||
| Vibrio vulnificus CMCP6 | 2 | 1 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| nhaX |
|
|
|
*
Vibrio fischeri ES114 Site: position = -116 score = 7.51604 sequence = TTCATGTAAGCGCTTACATGAG Gene: VF_1254: Predicted sugar transporter, Na+/H+ antiporter family |
|
*
Photobacterium profundum SS9 Site: position = -134 score = 7.58068 sequence = CTCATGTAACCGCTTACATGAA Gene: PBPRA2147: Predicted sugar transporter, Na+/H+ antiporter family |
*
Vibrio salmonicida LFI1238 Site: position = -116 score = 7.66497 sequence = CCCATGTAAGCGCTTACATGAG Gene: VSAL_I1609: Predicted sugar transporter, Na+/H+ antiporter family |
*
Vibrio shilonii AK1 Site: position = -108 score = 7.79426 sequence = CTCATGTAAGCGCTTACATGAA Gene: VSAK1_02689: Predicted sugar transporter, Na+/H+ antiporter family |
|
*
Vibrio vulnificus CMCP6 Site: position = -109 score = 7.72962 sequence = CCCATGTAAGCGCTTACATGAA Gene: VV21061: Predicted sugar transporter, Na+/H+ antiporter family |
Predicted sugar transporter, Na+/H+ antiporter family |
| malY |
|
|
|
Gene: VF_1253: beta-cystathionase; Maltose regulon modulator |
|
Gene: PBPRA2148: beta-cystathionase; Maltose regulon modulator |
Gene: VSAL_I1610: beta-cystathionase; Maltose regulon modulator |
Gene: VSAK1_02694: beta-cystathionase; Maltose regulon modulator |
|
Gene: VV21062: beta-cystathionase; Maltose regulon modulator |
beta-cystathionase; Maltose regulon modulator |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |