Regulog SuxR - Xanthomonadales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Stenotrophomonas maltophilia K279a
Xanthomonas axonopodis pv. citri str. 306	3	2
Xanthomonas campestris pv. campestris str. ATCC 33913	3	2
Xylella fastidiosa 9a5c

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
omp_suc	Stenotrophomonas maltophilia K279a	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -190 score = 7.30831 sequence = CGTTGCAATCGATTGTAACG Gene: XAC3489: Predicted sucrose-specific outer membrane transporter, TonB-dependent	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -190 score = 7.12357 sequence = CTTTGCAATCGATTGTAACG Gene: XCC3358: Predicted sucrose-specific outer membrane transporter, TonB-dependent	Xylella fastidiosa 9a5c	Predicted sucrose-specific outer membrane transporter, TonB-dependent
ams	Stenotrophomonas maltophilia K279a	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC3490: Amylosucrase	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC3359: Amylosucrase	Xylella fastidiosa 9a5c	Amylosucrase

CRON 2.
sut1	Stenotrophomonas maltophilia K279a	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -78 score = 7.30831 sequence = CGTTACAATCGATTGCAACG Gene: XAC3488: Sucrose transport protein SUT1	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -77 score = 7.12357 sequence = CGTTACAATCGATTGCAAAG Gene: XCC3357: Sucrose transport protein SUT1	Xylella fastidiosa 9a5c	Sucrose transport protein SUT1

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --