Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing ams gene

Properties
Regulog: SuxR - Xanthomonadales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose
Phylum: Proteobacteria/gamma
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Xanthomonas axonopodis pv. citri str. 306
Position: -190
Score: 7.30831
Sequence: CGTTGCAATCGATTGTAACG
Locus tag: XAC3489
Name: omp_suc
Funciton: Predicted sucrose-specific outer membrane transporter, TonB-dependent
Locus tag: XAC3490
Name: ams
Funciton: Amylosucrase
omp_suc-ams -190 7.3 CGTTGCAATCGATTGTAACG XAC3489
Xanthomonas campestris pv. campestris str. ATCC 33913
Position: -190
Score: 7.12357
Sequence: CTTTGCAATCGATTGTAACG
Locus tag: XCC3358
Name: omp_suc
Funciton: Predicted sucrose-specific outer membrane transporter, TonB-dependent
Locus tag: XCC3359
Name: ams
Funciton: Amylosucrase
omp_suc-ams -190 7.1 CTTTGCAATCGATTGTAACG XCC3358