Regulog FruR2 - Xanthomonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Fructose utilization |
| Effector: | Fructose-1-phosphate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Xanthomonadales
- By TF family - LacI
- By effector - Fructose-1-phosphate
- By pathway - Fructose utilization
| Genome | Genes | Operons |
|---|---|---|
| Stenotrophomonas maltophilia K279a | 5 | 2 |
| Xanthomonas axonopodis pv. citri str. 306 | 5 | 2 |
| Xanthomonas campestris pv. campestris str. ATCC 33913 | 5 | 2 |
| Xylella fastidiosa 9a5c |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| fruB |
*
Stenotrophomonas maltophilia K279a Site: position = 3 score = 6.44401 sequence = CAGTGGGAACGTTCCCAATA Site: position = -106 score = 5.88552 sequence = CATTGGAAACGTTCCCGGAA Gene: Smlt2556: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
*
Xanthomonas axonopodis pv. citri str. 306 Site: position = -164 score = 5.20892 sequence = CACTGGGACCGTTCCCGCTC Site: position = -53 score = 6.95441 sequence = TCGTGGGAACGTTCCCACTA Gene: XAC2501: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -165 score = 5.20892 sequence = CACTGGGACCGTTCCCGCTC Site: position = -55 score = 6.83785 sequence = CCGTGGGAACGTTCCCACTA Gene: XCC2370: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
|
PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
| fruK |
Gene: Smlt2557: 1-phosphofructokinase (EC 2.7.1.56) |
Gene: XAC2502: 1-phosphofructokinase (EC 2.7.1.56) |
Gene: XCC2371: 1-phosphofructokinase (EC 2.7.1.56) |
|
1-phosphofructokinase (EC 2.7.1.56) |
| fruA |
Gene: Smlt2558: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69) |
Gene: XAC2503: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69) |
Gene: XCC2372: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69) |
|
PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69) |
| fruO |
Gene: Smlt2559: Predicted fructose-specific outer membrane porin |
Gene: XAC2504: Predicted fructose-specific outer membrane porin |
Gene: XCC2373: Predicted fructose-specific outer membrane porin |
|
Predicted fructose-specific outer membrane porin |
| CRON 2. | |||||
| fruR2 |
*
Stenotrophomonas maltophilia K279a Site: position = -126 score = 6.83785 sequence = TATTGGGAACGTTCCCACTG Gene: Smlt2555: Transcriptional regulator for fructose utilization, LacI family |
*
Xanthomonas axonopodis pv. citri str. 306 Site: position = -17 score = 5.13716 sequence = GAGCGGGAACGGTCCCAGTG Site: position = -128 score = 7.0039 sequence = TAGTGGGAACGTTCCCACGA Gene: XAC2500: Transcriptional regulator for fructose utilization, LacI family |
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -127 score = 6.88734 sequence = TAGTGGGAACGTTCCCACGG Site: position = -17 score = 5.13716 sequence = GAGCGGGAACGGTCCCAGTG Gene: XCC2369: Transcriptional regulator for fructose utilization, LacI family |
|
Transcriptional regulator for fructose utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |