Regulog ScrR - Vibrionales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Vibrionales
- By TF family - LacI
- By effector - Sucrose-6-phosphate
- By pathway - Sucrose utilization
| Genome | Genes | Operons |
|---|---|---|
| Photobacterium profundum SS9 | ||
| Vibrio angustum S14 | ||
| Vibrio cholerae O1 biovar eltor str. N16961 | 4 | 4 |
| Vibrio fischeri ES114 | ||
| Vibrio harveyi ATCC BAA-1116 | ||
| Vibrio parahaemolyticus RIMD 2210633 | ||
| Vibrio salmonicida LFI1238 | ||
| Vibrio shilonii AK1 | ||
| Vibrio splendidus LGP32 | ||
| Vibrio vulnificus CMCP6 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| scrB |
|
|
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -39 score = 5.70083 sequence = AATTGAGAACGTTCCCGAAT Gene: VCA0655: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
|
|
|
|
|
|
|
Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
| CRON 2. | |||||||||||
| scrK |
|
|
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -117 score = 5.54847 sequence = AATAGGTAACGTTCCCGAAA Gene: VCA0656: Fructokinase (EC 2.7.1.4) |
|
|
|
|
Gene: VSAK1_21069: Fructokinase (EC 2.7.1.4) |
|
|
Fructokinase (EC 2.7.1.4) |
| CRON 3. | |||||||||||
| scrR |
|
|
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -192 score = 6.17356 sequence = TTTCGGGAACGTTTGCAAAA Gene: VCA0654: Sucrose operon repressor ScrR, LacI family |
|
|
|
|
|
|
|
Sucrose operon repressor ScrR, LacI family |
| CRON 4. | |||||||||||
| scrA |
|
|
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -128 score = 6.17356 sequence = TTTTGCAAACGTTCCCGAAA Gene: VCA0653: PTS system, sucrose-specific IIB component (EC 2.7.1.69) / PTS system, sucrose-specific IIC component (EC 2.7.1.69) |
|
|
|
|
|
|
|
PTS system, sucrose-specific IIB component (EC 2.7.1.69) / PTS system, sucrose-specific IIC component (EC 2.7.1.69) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |