Regulog CadR-PbrR - Rhodospirillales

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum:	Proteobacteria/Alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Rhodospirillum rubrum ATCC 11170	1	1
Magnetospirillum magnetotacticum MS-1	2	1
Magnetospirillum magneticum AMB-1
Azospirillum sp. B510	1	1
Rhodospirillum centenum SW
Gluconacetobacter diazotrophicus PAl 5
Acetobacter pasteurianus IFO 3283-01
Gluconobacter oxydans 621H
Granulibacter bethesdensis CGDNIH1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
czcD	Rhodospirillum rubrum ATCC 11170 Gene: Rru_A1698: Co/Zn/Cd efflux protein	2 Magnetospirillum magnetotacticum MS-1* Gene: Magn03007547: Co/Zn/Cd efflux protein Site: position = -192 score = 5.68532 sequence = AACCTCCAGTGACTGGAGATC Gene: Magn03007548: Co/Zn/Cd efflux protein	Magnetospirillum magneticum AMB-1	Azospirillum sp. B510	Rhodospirillum centenum SW Gene: RC1_3841: Co/Zn/Cd efflux protein	Gluconacetobacter diazotrophicus PAl 5	Acetobacter pasteurianus IFO 3283-01	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	Co/Zn/Cd efflux protein

CRON 2.
cadA	* Rhodospirillum rubrum ATCC 11170 Site: position = -66 score = 6.21905 sequence = ATCCTCTAGTCGCTAGAGATT Gene: Rru_A1027: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)	Magnetospirillum magnetotacticum MS-1	Magnetospirillum magneticum AMB-1	* Azospirillum sp. B510 Site: position = -58 score = 6.04791 sequence = ATCCTCCAGTCGCTAGAGAAT Gene: AZL_a07690: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)	Rhodospirillum centenum SW	Gluconacetobacter diazotrophicus PAl 5	Acetobacter pasteurianus IFO 3283-01	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --