Regulog CadR-PbrR - Pasteurellales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Pasteurellales
- By trascription factor - CadR-PbrR
- By TF family - MerR
- By effector - Lead ion, (Pb2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Lead resistance
- By pathway - Cadmium resistance
| Genome | Genes | Operons |
|---|---|---|
| Haemophilus influenzae Rd KW20 | ||
| Aggregatibacter aphrophilus NJ8700 | ||
| Pasteurella multocida subsp. multocida str. Pm70 | 1 | 1 |
| Mannheimia succiniciproducens MBEL55E | 1 | 1 |
| Actinobacillus succinogenes 130Z | ||
| Haemophilus somnus 2336 | 1 | 1 |
| Actinobacillus pleuropneumoniae serovar 7 str. AP76 | ||
| Haemophilus ducreyi 35000HP | ||
| Haemophilus parasuis SH0165 | 1 | 1 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| czcD |
|
|
*2
Pasteurella multocida subsp. multocida str. Pm70 Site: position = -63 score = 5.67555 sequence = ACCCTGTAATGACTACGGAGT Gene: PM1942: Co/Zn/Cd efflux protein Gene: PM1337: Co/Zn/Cd efflux protein |
*
Mannheimia succiniciproducens MBEL55E Site: position = -77 score = 5.25819 sequence = AGTCTGTAGTAGCTACGGAGT Gene: MS1434: Co/Zn/Cd efflux protein |
Gene: Asuc_1517: Co/Zn/Cd efflux protein |
*
Haemophilus somnus 2336 Site: position = -62 score = 5.67555 sequence = ACCCTGTAATGACTACGGAGT Gene: HSM_1740: Co/Zn/Cd efflux protein |
|
|
*
Haemophilus parasuis SH0165 Site: position = -61 score = 5.67555 sequence = ACCCTGTAATGACTACGGAGT Gene: HAPS_1831: Co/Zn/Cd efflux protein |
Co/Zn/Cd efflux protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |