Regulog CadR-PbrR - Pasteurellales

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum:	Proteobacteria/Gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Haemophilus influenzae Rd KW20
Aggregatibacter aphrophilus NJ8700
Pasteurella multocida subsp. multocida str. Pm70	1	1
Mannheimia succiniciproducens MBEL55E	1	1
Actinobacillus succinogenes 130Z
Haemophilus somnus 2336	1	1
Actinobacillus pleuropneumoniae serovar 7 str. AP76
Haemophilus ducreyi 35000HP
Haemophilus parasuis SH0165	1	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
czcD	Haemophilus influenzae Rd KW20	Aggregatibacter aphrophilus NJ8700	2 Pasteurella multocida subsp. multocida str. Pm70* Site: position = -63 score = 5.67555 sequence = ACCCTGTAATGACTACGGAGT Gene: PM1942: Co/Zn/Cd efflux protein Gene: PM1337: Co/Zn/Cd efflux protein	* Mannheimia succiniciproducens MBEL55E Site: position = -77 score = 5.25819 sequence = AGTCTGTAGTAGCTACGGAGT Gene: MS1434: Co/Zn/Cd efflux protein	Actinobacillus succinogenes 130Z Gene: Asuc_1517: Co/Zn/Cd efflux protein	* Haemophilus somnus 2336 Site: position = -62 score = 5.67555 sequence = ACCCTGTAATGACTACGGAGT Gene: HSM_1740: Co/Zn/Cd efflux protein	Actinobacillus pleuropneumoniae serovar 7 str. AP76	Haemophilus ducreyi 35000HP	* Haemophilus parasuis SH0165 Site: position = -61 score = 5.67555 sequence = ACCCTGTAATGACTACGGAGT Gene: HAPS_1831: Co/Zn/Cd efflux protein	Co/Zn/Cd efflux protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --