Regulog MerR - Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Mercury resistance |
| Effector: | Mercury ion, (Hg2+) |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Alteromonadales
- By trascription factor - MerR
- By TF family - MerR
- By effector - Mercury ion, (Hg2+)
- By pathway - Mercury resistance
| Genome | Genes | Operons |
|---|---|---|
| Pseudoalteromonas atlantica T6c | ||
| Alteromonas macleodii 'Deep ecotype' | 10 | 4 |
| Glaciecola sp. HTCC2999 | ||
| Colwellia psychrerythraea 34H | ||
| Alteromonadales bacterium TW-7 | ||
| Pseudoalteromonas haloplanktis TAC125 | ||
| Pseudoalteromonas tunicata D2 | ||
| Idiomarina baltica OS145 | 3 | 1 |
| Idiomarina loihiensis L2TR | 3 | 1 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| merT4 |
|
*
Alteromonas macleodii 'Deep ecotype' Site: position = -61 score = 5.15614 sequence = ACAGCGTACATTAGTACGGCAT Gene: MADE_02957: Mercury uptake inner membane protein |
|
|
|
|
|
|
|
Mercury uptake inner membane protein |
| CRON 2. | ||||||||||
| merT2 |
|
*
Alteromonas macleodii 'Deep ecotype' Site: position = -83 score = 4.99202 sequence = ACTCCGTACTTAGGTACATGCA Gene: MADE_01411: Mercury uptake inner membane protein |
|
|
|
|
|
|
|
Mercury uptake inner membane protein |
| merP2 |
|
2
Alteromonas macleodii 'Deep ecotype' Gene: MADE_02043: Periplasmic mercury(+2) binding protein Gene: MADE_01410: Periplasmic mercury(+2) binding protein |
|
|
|
|
|
|
|
Periplasmic mercury(+2) binding protein |
| merC2 |
|
Gene: MADE_01409: Mercury uptake inner membane protein |
|
|
|
|
|
|
|
Mercury uptake inner membane protein |
| merA2 |
|
2
Alteromonas macleodii 'Deep ecotype' Gene: MADE_01408: Mercuric ion reductase (EC 1.16.1.1) Gene: MADE_02044: Mercuric ion reductase (EC 1.16.1.1) |
|
|
|
|
|
|
|
Mercuric ion reductase (EC 1.16.1.1) |
| merD2 |
|
Gene: MADE_01407: Mercuric resistance operon coregulator |
|
|
|
|
|
|
|
Mercuric resistance operon coregulator |
| CRON 3. | ||||||||||
| merT3 |
|
*
Alteromonas macleodii 'Deep ecotype' Site: position = -149 score = 5.29407 sequence = ACTCGGTACCACGGTACTGAGT Gene: MADE_02959: Mercury uptake inner membane protein |
|
|
|
|
|
|
|
Mercury uptake inner membane protein |
| merP3 |
|
Gene: MADE_02958: Periplasmic mercury(+2) binding protein |
|
|
|
|
|
|
|
Periplasmic mercury(+2) binding protein |
| CRON 4. | ||||||||||
| merT |
|
|
|
|
|
|
|
*
Idiomarina baltica OS145 Site: position = -66 score = 5.06231 sequence = CTTCCGTAGTGAGGTACGGGTC Gene: OS145_03813: Mercury uptake inner membane protein |
*
Idiomarina loihiensis L2TR Site: position = -66 score = 5.30676 sequence = CTTCCGTAGTGAGGTACGGGTT Gene: IL1644: Mercury uptake inner membane protein |
Mercury uptake inner membane protein |
| merP |
|
|
|
|
|
|
|
Gene: OS145_03818: Periplasmic mercury(+2) binding protein |
Gene: IL1645: Periplasmic mercury(+2) binding protein |
Periplasmic mercury(+2) binding protein |
| merA |
|
*
Alteromonas macleodii 'Deep ecotype' Site: position = -10 score = 6.09032 sequence = ACTCCGTACAATGGTACGGCGT Gene: MADE_02949: Mercuric ion reductase (EC 1.16.1.1) |
|
|
|
|
|
Gene: OS145_03823: Mercuric ion reductase (EC 1.16.1.1) |
Gene: IL1646: Mercuric ion reductase (EC 1.16.1.1) |
Mercuric ion reductase (EC 1.16.1.1) |
| merB |
|
Gene: MADE_02948: Organomercurial lyase |
|
|
|
|
|
|
|
Organomercurial lyase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |