Regulog ZntR - Oceanospirillales/Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Zinc resistance |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By trascription factor - ZntR
- By TF family - MerR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc resistance
| Genome | Genes | Operons |
|---|---|---|
| Hahella chejuensis KCTC 2396 | ||
| Marinobacter aqueolei | ||
| Marinobacter sp. ELB17 | ||
| Oceanobacter sp. RED65 | ||
| Oceanospirillum sp. MED92 | 1 | 1 |
| Marinomonas sp. MWYL1 | 1 | 1 |
| Saccharophagus degradans 2-40 | ||
| Teredinibacter turnerae T7901 | ||
| Cellvibrio japonicus Ueda107 | ||
| Chromohalobacter salexigens DSM 3043 | 1 | 1 |
| Reinekea sp. MED297 | 1 | 1 |
| Alcanivorax borkumensis SK2 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| zntA |
|
|
|
|
*
Oceanospirillum sp. MED92 Site: position = -60 score = 6.08681 sequence = ACCCTGAAGTTTACTTCAGGGT Gene: MED92_02778: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5) |
*2
Marinomonas sp. MWYL1 Site: position = -60 score = 5.39889 sequence = ACCTTGGACTATTATCCAAGGT Gene: Mmwyl1_1611: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5) Gene: Mmwyl1_2255: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5) |
|
|
|
Gene: Csal_3006: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5) |
*
Reinekea sp. MED297 Site: position = -18 score = 4.75139 sequence = ACTCTATAGTAAGCTCGAATGT Gene: MED297_07836: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5) |
|
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5) |
| CRON 2. | |||||||||||||
| COG1230 |
Gene: HCH_03680: Co/Zn/Cd efflux system component |
|
|
|
|
|
|
|
|
*
Chromohalobacter salexigens DSM 3043 Site: position = -67 score = 5.03626 sequence = GACCTGGAGTGCACTCCAGGGT Gene: Csal_1006: Co/Zn/Cd efflux system component |
|
|
Co/Zn/Cd efflux system component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |