Regulog SoxR - Ralstonia
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Ralstonia
- By trascription factor - SoxR
- By TF family - MerR
- By effector - Paraquat
- By pathway - Superoxide stress response
| Genome | Genes | Operons |
|---|---|---|
| Ralstonia solanacearum GMI1000 | ||
| Ralstonia pickettii 12J | ||
| Ralstonia metallidurans CH34 | 1 | 1 |
| Ralstonia eutropha JMP134 | ||
| Ralstonia eutropha H16 | 1 | 1 |
| Cupriavidus taiwanensis | 1 | 1 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| PF01042 |
|
|
*
Ralstonia metallidurans CH34 Site: position = -56 score = 6.09669 sequence = ACCTCAAGCGTGCTTGAGGT Gene: Rmet_4539: Endoribonuclease L-PSP |
|
*
Ralstonia eutropha H16 Site: position = -73 score = 6.42286 sequence = ACCTCAATTTAGGTTGAGGT Gene: H16_B2318: Endoribonuclease L-PSP |
*
Cupriavidus taiwanensis Site: position = -151 score = 6.29825 sequence = ACCTTAACCTAACTTGAGGT Gene: RALTA_B2082: Endoribonuclease L-PSP |
Endoribonuclease L-PSP |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |