Regulog HrcA - Sphingomonadales
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Sphingomonadales
- By trascription factor - HrcA
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Erythrobacter litoralis HTCC2594 | 2 | 1 |
| Erythrobacter sp. NAP1 | 2 | 1 |
| Novosphingobium aromaticivorans DSM 12444 | 2 | 1 |
| Sphingopyxis alaskensis RB2256 | 2 | 1 |
| Sphingobium japonicum UT26S | 2 | 1 |
| Sphingomonas wittichii RW1 | 2 | 1 |
| Zymomonas mobilis subsp. mobilis ZM4 | 2 | 1 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| groS |
*
Erythrobacter litoralis HTCC2594 Site: position = -64 score = 7.24169 sequence = CTGGCACTCTCTGGACGAGAGTGCCAA Gene: ELI_14405: Heat shock protein 60 family co-chaperone GroES |
*
Erythrobacter sp. NAP1 Site: position = -63 score = 7.03604 sequence = CTGGCACTCTTATGCCAAGAGTGCCAA Gene: NAP1_11773: Heat shock protein 60 family co-chaperone GroES |
*
Novosphingobium aromaticivorans DSM 12444 Site: position = -61 score = 7.32406 sequence = CTGGCACTCTCGGGTTGAGAGTGCCAA Gene: Saro_0034: Heat shock protein 60 family co-chaperone GroES |
*
Sphingopyxis alaskensis RB2256 Site: position = -59 score = 6.95142 sequence = TTAGCACTCTCCTGTGGCGAGTGCTAA Gene: Sala_0453: Heat shock protein 60 family co-chaperone GroES |
*
Sphingobium japonicum UT26S Site: position = -120 score = 6.96335 sequence = CTGGCACTCCCCGACGAGGAGTGCTAA Gene: SJA_C1-21260: Heat shock protein 60 family co-chaperone GroES |
*
Sphingomonas wittichii RW1 Site: position = -100 score = 6.44354 sequence = CTGGCACTCGCTTCCGGTGAGTGCTAA Gene: Swit_3375: Heat shock protein 60 family co-chaperone GroES |
*
Zymomonas mobilis subsp. mobilis ZM4 Site: position = 10 score = 6.51922 sequence = TTGGCACTTCGCAAGGGAGAGTGCCAG Gene: ZMO1928: Heat shock protein 60 family co-chaperone GroES |
Heat shock protein 60 family co-chaperone GroES |
| groL |
Gene: ELI_14400: Heat shock protein 60 family chaperone GroEL |
Gene: NAP1_11778: Heat shock protein 60 family chaperone GroEL |
Gene: Saro_0035: Heat shock protein 60 family chaperone GroEL |
Gene: Sala_0452: Heat shock protein 60 family chaperone GroEL |
Gene: SJA_C1-21250: Heat shock protein 60 family chaperone GroEL |
Gene: Swit_3376: Heat shock protein 60 family chaperone GroEL |
Gene: ZMO1929: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |