Statistics of regulated genes

Genome	Genes	Operons
Rhodobacter sphaeroides 2.4.1	2	1
Paracoccus denitrificans PD1222	1	1
Jannaschia sp. CCS1	2	1
Rhodobacterales bacterium HTCC2654	2	1
Oceanicola granulosus HTCC2516	2	1
Loktanella vestfoldensis SKA53	2	1
Oceanicola batsensis HTCC2597	2	1
Roseovarius nubinhibens ISM	2	1
Roseovarius sp. 217	2	1
Sulfitobacter sp. EE-36	2	1
Silicibacter TM1040	2	1
Silicibacter pomeroyi DSS-3	2	1
Roseobacter sp. MED193	2	1
Hyphomonas neptunium ATCC 15444	2	1
Oceanicaulis alexandrii HTCC2633	2	1

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes																Function
CRON 1.
groS	* Rhodobacter sphaeroides 2.4.1 Site: position = -62 score = 7.47934 sequence = TTGGCACTCGCCTCGGGTGAGTGCTAA Gene: RSP_2310: Heat shock protein 60 family co-chaperone GroES	Paracoccus denitrificans PD1222 Gene: Pden_4586: Heat shock protein 60 family co-chaperone GroES	* Jannaschia sp. CCS1 Site: position = -72 score = 6.87594 sequence = TTGGCACTCGCGTTCGGTGAGTGCTAA Gene: Jann_3359: Heat shock protein 60 family co-chaperone GroES	* Rhodobacterales bacterium HTCC2654 Site: position = -86 score = 7.44085 sequence = TTAGCACTCACCCCCGGTGAGTGCCAA Gene: RB2654_08122: Heat shock protein 60 family co-chaperone GroES	* Oceanicola granulosus HTCC2516 Site: position = -54 score = 7.46222 sequence = TTAGCACTCACACCGAGCGAGTGCTAA Gene: OG2516_17151: Heat shock protein 60 family co-chaperone GroES	* Loktanella vestfoldensis SKA53 Site: position = -60 score = 7.06707 sequence = TTGGCACTCGGACTGGCTGAGTGCTAA Gene: SKA53_08661: Heat shock protein 60 family co-chaperone GroES	* Oceanicola batsensis HTCC2597 Site: position = -94 score = 7.14612 sequence = TTAGCACTCGCGTGGTGTGAGTGATAA Gene: OB2597_07485: Heat shock protein 60 family co-chaperone GroES	* Roseovarius nubinhibens ISM Site: position = -79 score = 7.23806 sequence = TTAGCACTCGGAGGGACTGAGTGCTAA Gene: ISM_05760: Heat shock protein 60 family co-chaperone GroES	* Roseovarius sp. 217 Site: position = -81 score = 6.9919 sequence = TTAGCACTCGAACCCCATGAGTGCTAA Gene: ROS217_12501: Heat shock protein 60 family co-chaperone GroES	* Sulfitobacter sp. EE-36 Site: position = -92 score = 7.56521 sequence = TTAGCACTCGGCAGGGCTGAGTGCTAA Gene: EE36_03888: Heat shock protein 60 family co-chaperone GroES	* Silicibacter TM1040 Site: position = -94 score = 7.45218 sequence = TTAGCACTCGACTGAGGTGAGTGCTAA Gene: TM1040_0596: Heat shock protein 60 family co-chaperone GroES	* Silicibacter pomeroyi DSS-3 Site: position = -86 score = 7.18488 sequence = TTAGCACTCGTCAGACCTGAGTGCTAA Gene: SPO0886: Heat shock protein 60 family co-chaperone GroES	* Roseobacter sp. MED193 Site: position = -93 score = 7.05966 sequence = TTAGCACTCATCAGGTGTGAGTGATAA Gene: MED193_20209: Heat shock protein 60 family co-chaperone GroES	* Hyphomonas neptunium ATCC 15444 Site: position = -110 score = 7.35483 sequence = TTAGCAGTCGGCTCGGGCGAGTGCTAA Gene: HNE_1961: Heat shock protein 60 family co-chaperone GroES	* Oceanicaulis alexandrii HTCC2633 Site: position = -94 score = 6.40188 sequence = TTAGCAGCCAGGGCAGGAGAGTGCTAA Gene: OA2633_05922: Heat shock protein 60 family co-chaperone GroES	Heat shock protein 60 family co-chaperone GroES
groL	2 Rhodobacter sphaeroides 2.4.1 Gene: RSP_2311: Heat shock protein 60 family chaperone GroEL Gene: RSP_3615: Heat shock protein 60 family chaperone GroEL	*2 Paracoccus denitrificans PD1222 Site: position = -396 score = 7.16837 sequence = TTGGCACTCACCCGAGCCGAGTGCCAA Gene: Pden_3654: Heat shock protein 60 family chaperone GroEL Gene: Pden_4585: Heat shock protein 60 family chaperone GroEL	Jannaschia sp. CCS1 Gene: Jann_3358: Heat shock protein 60 family chaperone GroEL	Rhodobacterales bacterium HTCC2654 Gene: RB2654_08117: Heat shock protein 60 family chaperone GroEL	Oceanicola granulosus HTCC2516 Gene: OG2516_17146: Heat shock protein 60 family chaperone GroEL	Loktanella vestfoldensis SKA53 Gene: SKA53_08666: Heat shock protein 60 family chaperone GroEL	Oceanicola batsensis HTCC2597 Gene: OB2597_07480: Heat shock protein 60 family chaperone GroEL	Roseovarius nubinhibens ISM Gene: ISM_05755: Heat shock protein 60 family chaperone GroEL	Roseovarius sp. 217 Gene: ROS217_12506: Heat shock protein 60 family chaperone GroEL	Sulfitobacter sp. EE-36 Gene: EE36_03883: Heat shock protein 60 family chaperone GroEL	Silicibacter TM1040 Gene: TM1040_0597: Heat shock protein 60 family chaperone GroEL	Silicibacter pomeroyi DSS-3 Gene: SPO0887: Heat shock protein 60 family chaperone GroEL	Roseobacter sp. MED193 Gene: MED193_20214: Heat shock protein 60 family chaperone GroEL	Hyphomonas neptunium ATCC 15444 Gene: HNE_1962: Heat shock protein 60 family chaperone GroEL	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_05927: Heat shock protein 60 family chaperone GroEL	Heat shock protein 60 family chaperone GroEL

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD