Regulog HrcA - Rhodobacterales
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhodobacterales
- By trascription factor - HrcA
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Rhodobacter sphaeroides 2.4.1 | 2 | 1 |
| Paracoccus denitrificans PD1222 | 1 | 1 |
| Jannaschia sp. CCS1 | 2 | 1 |
| Rhodobacterales bacterium HTCC2654 | 2 | 1 |
| Oceanicola granulosus HTCC2516 | 2 | 1 |
| Loktanella vestfoldensis SKA53 | 2 | 1 |
| Oceanicola batsensis HTCC2597 | 2 | 1 |
| Roseovarius nubinhibens ISM | 2 | 1 |
| Roseovarius sp. 217 | 2 | 1 |
| Sulfitobacter sp. EE-36 | 2 | 1 |
| Silicibacter TM1040 | 2 | 1 |
| Silicibacter pomeroyi DSS-3 | 2 | 1 |
| Roseobacter sp. MED193 | 2 | 1 |
| Hyphomonas neptunium ATCC 15444 | 2 | 1 |
| Oceanicaulis alexandrii HTCC2633 | 2 | 1 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| groS |
*
Rhodobacter sphaeroides 2.4.1 Site: position = -62 score = 7.47934 sequence = TTGGCACTCGCCTCGGGTGAGTGCTAA Gene: RSP_2310: Heat shock protein 60 family co-chaperone GroES |
Gene: Pden_4586: Heat shock protein 60 family co-chaperone GroES |
*
Jannaschia sp. CCS1 Site: position = -72 score = 6.87594 sequence = TTGGCACTCGCGTTCGGTGAGTGCTAA Gene: Jann_3359: Heat shock protein 60 family co-chaperone GroES |
*
Rhodobacterales bacterium HTCC2654 Site: position = -86 score = 7.44085 sequence = TTAGCACTCACCCCCGGTGAGTGCCAA Gene: RB2654_08122: Heat shock protein 60 family co-chaperone GroES |
*
Oceanicola granulosus HTCC2516 Site: position = -54 score = 7.46222 sequence = TTAGCACTCACACCGAGCGAGTGCTAA Gene: OG2516_17151: Heat shock protein 60 family co-chaperone GroES |
*
Loktanella vestfoldensis SKA53 Site: position = -60 score = 7.06707 sequence = TTGGCACTCGGACTGGCTGAGTGCTAA Gene: SKA53_08661: Heat shock protein 60 family co-chaperone GroES |
*
Oceanicola batsensis HTCC2597 Site: position = -94 score = 7.14612 sequence = TTAGCACTCGCGTGGTGTGAGTGATAA Gene: OB2597_07485: Heat shock protein 60 family co-chaperone GroES |
*
Roseovarius nubinhibens ISM Site: position = -79 score = 7.23806 sequence = TTAGCACTCGGAGGGACTGAGTGCTAA Gene: ISM_05760: Heat shock protein 60 family co-chaperone GroES |
*
Roseovarius sp. 217 Site: position = -81 score = 6.9919 sequence = TTAGCACTCGAACCCCATGAGTGCTAA Gene: ROS217_12501: Heat shock protein 60 family co-chaperone GroES |
*
Sulfitobacter sp. EE-36 Site: position = -92 score = 7.56521 sequence = TTAGCACTCGGCAGGGCTGAGTGCTAA Gene: EE36_03888: Heat shock protein 60 family co-chaperone GroES |
*
Silicibacter TM1040 Site: position = -94 score = 7.45218 sequence = TTAGCACTCGACTGAGGTGAGTGCTAA Gene: TM1040_0596: Heat shock protein 60 family co-chaperone GroES |
*
Silicibacter pomeroyi DSS-3 Site: position = -86 score = 7.18488 sequence = TTAGCACTCGTCAGACCTGAGTGCTAA Gene: SPO0886: Heat shock protein 60 family co-chaperone GroES |
*
Roseobacter sp. MED193 Site: position = -93 score = 7.05966 sequence = TTAGCACTCATCAGGTGTGAGTGATAA Gene: MED193_20209: Heat shock protein 60 family co-chaperone GroES |
*
Hyphomonas neptunium ATCC 15444 Site: position = -110 score = 7.35483 sequence = TTAGCAGTCGGCTCGGGCGAGTGCTAA Gene: HNE_1961: Heat shock protein 60 family co-chaperone GroES |
*
Oceanicaulis alexandrii HTCC2633 Site: position = -94 score = 6.40188 sequence = TTAGCAGCCAGGGCAGGAGAGTGCTAA Gene: OA2633_05922: Heat shock protein 60 family co-chaperone GroES |
Heat shock protein 60 family co-chaperone GroES |
| groL |
2
Rhodobacter sphaeroides 2.4.1 Gene: RSP_2311: Heat shock protein 60 family chaperone GroEL Gene: RSP_3615: Heat shock protein 60 family chaperone GroEL |
*2
Paracoccus denitrificans PD1222 Site: position = -396 score = 7.16837 sequence = TTGGCACTCACCCGAGCCGAGTGCCAA Gene: Pden_3654: Heat shock protein 60 family chaperone GroEL Gene: Pden_4585: Heat shock protein 60 family chaperone GroEL |
Gene: Jann_3358: Heat shock protein 60 family chaperone GroEL |
Gene: RB2654_08117: Heat shock protein 60 family chaperone GroEL |
Gene: OG2516_17146: Heat shock protein 60 family chaperone GroEL |
Gene: SKA53_08666: Heat shock protein 60 family chaperone GroEL |
Gene: OB2597_07480: Heat shock protein 60 family chaperone GroEL |
Gene: ISM_05755: Heat shock protein 60 family chaperone GroEL |
Gene: ROS217_12506: Heat shock protein 60 family chaperone GroEL |
Gene: EE36_03883: Heat shock protein 60 family chaperone GroEL |
Gene: TM1040_0597: Heat shock protein 60 family chaperone GroEL |
Gene: SPO0887: Heat shock protein 60 family chaperone GroEL |
Gene: MED193_20214: Heat shock protein 60 family chaperone GroEL |
Gene: HNE_1962: Heat shock protein 60 family chaperone GroEL |
Gene: OA2633_05927: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |