Regulog HrcA - Xanthomonadales
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Xanthomonadales
- By trascription factor - HrcA
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Xylella fastidiosa 9a5c | 2 | 1 |
| Xanthomonas axonopodis pv. citri str. 306 | 2 | 1 |
| Xanthomonas campestris pv. campestris str. ATCC 33913 | 2 | 1 |
| Stenotrophomonas maltophilia K279a | 2 | 1 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| groS |
*
Xylella fastidiosa 9a5c Site: position = -75 score = 6.85579 sequence = TTAGCACTCATTACATAAGAGTGCTAA Gene: XF0616: Heat shock protein 60 family co-chaperone GroES |
*
Xanthomonas axonopodis pv. citri str. 306 Site: position = -75 score = 6.88223 sequence = CTGGCAGTCGTCATGTACGAGTGCTAA Gene: XAC0541: Heat shock protein 60 family co-chaperone GroES |
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -77 score = 7.08568 sequence = CTGGCAGTCGTCACATACGAGTGCTAA Gene: XCC0522: Heat shock protein 60 family co-chaperone GroES |
*
Stenotrophomonas maltophilia K279a Site: position = -73 score = 6.77465 sequence = CTGGCACTCGCCTGGGGTGAGTGCTAA Gene: Smlt4215: Heat shock protein 60 family co-chaperone GroES |
Heat shock protein 60 family co-chaperone GroES |
| groL |
Gene: XF0615: Heat shock protein 60 family chaperone GroEL |
Gene: XAC0542: Heat shock protein 60 family chaperone GroEL |
Gene: XCC0523: Heat shock protein 60 family chaperone GroEL |
Gene: Smlt4214: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |