Regulog HrcA - Xanthomonadales

Properties
Regulator type:	Transcription factor
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Xylella fastidiosa 9a5c	2	1
Xanthomonas axonopodis pv. citri str. 306	2	1
Xanthomonas campestris pv. campestris str. ATCC 33913	2	1
Stenotrophomonas maltophilia K279a	2	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
groS	* Xylella fastidiosa 9a5c Site: position = -75 score = 6.85579 sequence = TTAGCACTCATTACATAAGAGTGCTAA Gene: XF0616: Heat shock protein 60 family co-chaperone GroES	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -75 score = 6.88223 sequence = CTGGCAGTCGTCATGTACGAGTGCTAA Gene: XAC0541: Heat shock protein 60 family co-chaperone GroES	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -77 score = 7.08568 sequence = CTGGCAGTCGTCACATACGAGTGCTAA Gene: XCC0522: Heat shock protein 60 family co-chaperone GroES	* Stenotrophomonas maltophilia K279a Site: position = -73 score = 6.77465 sequence = CTGGCACTCGCCTGGGGTGAGTGCTAA Gene: Smlt4215: Heat shock protein 60 family co-chaperone GroES	Heat shock protein 60 family co-chaperone GroES
groL	Xylella fastidiosa 9a5c Gene: XF0615: Heat shock protein 60 family chaperone GroEL	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC0542: Heat shock protein 60 family chaperone GroEL	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC0523: Heat shock protein 60 family chaperone GroEL	Stenotrophomonas maltophilia K279a Gene: Smlt4214: Heat shock protein 60 family chaperone GroEL	Heat shock protein 60 family chaperone GroEL

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --