Regulog MtlR - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | BglG |
| Regulation mode: | activator |
| Biological process: | Mannitol utilization |
| Effector: | HPr, phosphocarrier protein; MtlA, mannitol-specific enzyme IICB PTS component |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - BglG
- By effector - HPr, phosphocarrier protein
- By effector - MtlA, mannitol-specific enzyme IICB PTS component
- By pathway - Mannitol utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | ||
| Lactobacillus brevis ATCC 367 | ||
| Lactobacillus casei ATCC 334 | 4 | 1 |
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||
| Lactobacillus fermentum IFO 3956 | ||
| Lactobacillus helveticus DPC 4571 | ||
| Lactobacillus johnsonii NCC 533 | ||
| Lactobacillus plantarum WCFS1 | 4 | 1 |
| Lactobacillus reuteri JCM 1112 | ||
| Lactobacillus rhamnosus GG | 4 | 1 |
| Lactobacillus sakei subsp. sakei 23K | ||
| Lactobacillus salivarius subsp. salivarius UCC118 | 3 | 1 |
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | ||
| Oenococcus oeni PSU-1 | ||
| Pediococcus pentosaceus ATCC 25745 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| mtlA |
|
|
*
Lactobacillus casei ATCC 334 Site: position = -96 score = 7.48093 sequence = TTTGGCACAGACAACTGTGCCAAA Gene: LSEI_2888: PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69) |
|
|
|
|
*
Lactobacillus plantarum WCFS1 Site: position = -104 score = 6.66462 sequence = TGTGGCACAGTTTCCTGTGCCACG Gene: lp_0230: PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69) |
|
*
Lactobacillus rhamnosus GG Site: position = -96 score = 7.23981 sequence = TTTGGCACAACTAACTGTGCCAAA Gene: LGG_02912: PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69) |
|
*
Lactobacillus salivarius subsp. salivarius UCC118 Site: position = -110 score = 6.90296 sequence = TTTGACACTGACAACTGTGCCAAA Gene: LSL_1620: PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69) |
|
|
|
PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69) |
| mtlR |
|
|
Gene: LSEI_2887: Mannitol utilization transcription activator MtlR, BglG family |
|
|
|
|
Gene: lp_0231: Mannitol utilization transcription activator MtlR, BglG family |
|
Gene: LGG_02911: Mannitol utilization transcription activator MtlR, BglG family |
|
Gene: LSL_1628: Mannitol utilization transcription activator MtlR, BglG family |
|
|
|
Mannitol utilization transcription activator MtlR, BglG family |
| mtlF |
|
|
Gene: LSEI_2886: PTS system, mannitol-specific IIA component (EC 2.7.1.69) |
|
|
|
|
Gene: lp_0232: PTS system, mannitol-specific IIA component (EC 2.7.1.69) |
|
Gene: LGG_02910: PTS system, mannitol-specific IIA component (EC 2.7.1.69) |
|
Gene: LSL_1619: PTS system, mannitol-specific IIA component (EC 2.7.1.69) |
|
|
|
PTS system, mannitol-specific IIA component (EC 2.7.1.69) |
| mtlD |
|
|
Gene: LSEI_2885: Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17) |
|
|
|
|
Gene: lp_0233: Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17) |
|
Gene: LGG_02909: Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17) |
|
Gene: LSL_1618: Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17) |
|
|
|
Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |