Regulog CelQ - Streptococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | ROK |
| Regulation mode: | repressor |
| Biological process: | Cellobiose utilization |
| Effector: | Cellobiose-6-phosphate |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - ROK
- By effector - Cellobiose-6-phosphate
- By pathway - Cellobiose utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactococcus lactis subsp. cremoris SK11 | ||
| Lactococcus lactis subsp. lactis Il1403 | ||
| Streptococcus agalactiae 2603V/R | ||
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | ||
| Streptococcus equi subsp. zooepidemicus MGCS10565 | 6 | 2 |
| Streptococcus gallolyticus UCN34 | ||
| Streptococcus gordonii str. Challis substr. CH1 | ||
| Streptococcus mitis B6 | ||
| Streptococcus mutans UA159 | ||
| Streptococcus pneumoniae TIGR4 | 3 | 2 |
| Streptococcus pyogenes M1 GAS | ||
| Streptococcus sanguinis SK36 | 5 | 2 |
| Streptococcus suis 05ZYH33 | 4 | 2 |
| Streptococcus thermophilus CNRZ1066 | ||
| Streptococcus uberis 0140J |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| Sez_1430 |
|
|
|
|
*
Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -84 score = 6.61226 sequence = TTTGTTTATAAAAAGTAAACAAA Site: position = -38 score = 5.92584 sequence = TTTGTTAATATTTTTAAAATAAA Gene: Sez_1430: Conserved hypothetical protein |
|
|
|
|
|
|
Gene: SSA_0264: Conserved hypothetical protein |
|
|
|
Conserved hypothetical protein |
| celD2 |
|
|
|
|
Gene: Sez_1429: Cellobiose-specific PTS system, EIIB component (EC 2.7.1.69) |
|
|
|
|
|
|
*
Streptococcus sanguinis SK36 Site: position = -71 score = 6.54065 sequence = TTTGTTTATATATTGAAAATAAA Gene: SSA_0268: Cellobiose-specific PTS system, EIIB component (EC 2.7.1.69) |
|
|
|
Cellobiose-specific PTS system, EIIB component (EC 2.7.1.69) |
| celA2 |
|
|
|
|
Gene: Sez_1428: Cellobiose-specific PTS system, EIIA component (EC 2.7.1.69) |
|
|
|
|
|
|
Gene: SSA_0269: Cellobiose-specific PTS system, EIIA component (EC 2.7.1.69) |
|
|
|
Cellobiose-specific PTS system, EIIA component (EC 2.7.1.69) |
| celB2 |
|
|
|
|
2
Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_1427: Cellobiose-specific PTS system, EIIC component (EC 2.7.1.69) Gene: Sez_1426: Cellobiose-specific PTS system, EIIC component (EC 2.7.1.69) |
|
|
|
|
*
Streptococcus pneumoniae TIGR4 Site: position = -35 score = 6.36613 sequence = TTAATTTATAAAAAATAAAAAAA Gene: SP_0474: Cellobiose-specific PTS system, EIIC component (EC 2.7.1.69) |
|
Gene: SSA_0270: Cellobiose-specific PTS system, EIIC component (EC 2.7.1.69) |
*
Streptococcus suis 05ZYH33 Site: position = -45 score = 6.56718 sequence = TTTAATTAAAATTTATAAATAAA Gene: SSU05_0212: Cellobiose-specific PTS system, EIIC component (EC 2.7.1.69) |
|
|
Cellobiose-specific PTS system, EIIC component (EC 2.7.1.69) |
| lacZ |
|
|
|
|
|
|
|
|
|
|
|
Gene: SSA_0271: Beta-galactosidase (EC 3.2.1.23) |
|
|
|
Beta-galactosidase (EC 3.2.1.23) |
| SP_0475 |
|
|
|
|
|
|
|
|
|
Gene: SP_0475: Conserved hypothetical protein |
|
|
Gene: SSU05_0213: Conserved hypothetical protein |
|
|
Conserved hypothetical protein |
| CRON 2. | ||||||||||||||||
| celQ |
|
|
|
|
*
Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -164 score = 5.92584 sequence = TTTATTTTAAAAATATTAACAAA Site: position = -118 score = 6.61226 sequence = TTTGTTTACTTTTTATAAACAAA Gene: Sez_1431: Predicted cellobiose utilization transcriptional regulator, ROK family |
|
|
|
|
*
Streptococcus pneumoniae TIGR4 Site: position = -155 score = 6.36613 sequence = TTTTTTTATTTTTTATAAATTAA Gene: SP_0473: Predicted cellobiose utilization transcriptional regulator, ROK family |
|
*
Streptococcus sanguinis SK36 Site: position = -156 score = 6.54065 sequence = TTTATTTTCAATATATAAACAAA Gene: SSA_0267: Predicted cellobiose utilization transcriptional regulator, ROK family |
*2
Streptococcus suis 05ZYH33 Gene: SSU05_0210: Predicted cellobiose utilization transcriptional regulator, ROK family Site: position = -125 score = 6.56718 sequence = TTTATTTATAAATTTTAATTAAA Gene: SSU05_0211: Predicted cellobiose utilization transcriptional regulator, ROK family |
|
|
Predicted cellobiose utilization transcriptional regulator, ROK family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |