Regulog TreR - Streptococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Trehalose utilization |
| Effector: | Trehalose-6-phosphate |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - GntR/Others
- By effector - Trehalose-6-phosphate
- By pathway - Trehalose utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactococcus lactis subsp. cremoris SK11 | ||
| Lactococcus lactis subsp. lactis Il1403 | ||
| Streptococcus agalactiae 2603V/R | ||
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | 3 | 2 |
| Streptococcus equi subsp. zooepidemicus MGCS10565 | ||
| Streptococcus gallolyticus UCN34 | 3 | 2 |
| Streptococcus gordonii str. Challis substr. CH1 | 3 | 2 |
| Streptococcus mitis B6 | ||
| Streptococcus mutans UA159 | 3 | 2 |
| Streptococcus pneumoniae TIGR4 | 3 | 2 |
| Streptococcus pyogenes M1 GAS | 3 | 2 |
| Streptococcus sanguinis SK36 | 3 | 2 |
| Streptococcus suis 05ZYH33 | ||
| Streptococcus thermophilus CNRZ1066 | ||
| Streptococcus uberis 0140J | 3 | 2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| treR |
|
|
|
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -102 score = 5.99604 sequence = CAAATTTGTCTACAAGTTGT Gene: SDEG_2070: Trehalose utilization transcriptional regulator TreR, GntR family |
|
*
Streptococcus gallolyticus UCN34 Site: position = -116 score = 5.62441 sequence = CCATTTTGTCTGCAAGTTGT Gene: GALLO_2176: Trehalose utilization transcriptional regulator TreR, GntR family |
*
Streptococcus gordonii str. Challis substr. CH1 Site: position = -93 score = 5.40973 sequence = CAAACGTGTATGCAAGATGT Gene: SGO_1654: Trehalose utilization transcriptional regulator TreR, GntR family |
|
*
Streptococcus mutans UA159 Site: position = -99 score = 5.62683 sequence = CAAATTTGTTGGCAAGTTGT Gene: SMU.2040: Trehalose utilization transcriptional regulator TreR, GntR family |
*
Streptococcus pneumoniae TIGR4 Site: position = -124 score = 5.80387 sequence = CAAACTTGTCTGCAACTTGT Gene: SP_1885: Trehalose utilization transcriptional regulator TreR, GntR family |
*
Streptococcus pyogenes M1 GAS Site: position = -102 score = 5.99604 sequence = CAAATTTGTCTACAAGTTGT Gene: SPy2099: Trehalose utilization transcriptional regulator TreR, GntR family |
*
Streptococcus sanguinis SK36 Site: position = -91 score = 5.51578 sequence = CAAAGATGTATGCAAGTTGT Gene: SSA_1753: Trehalose utilization transcriptional regulator TreR, GntR family |
Gene: SSU05_0232: Trehalose utilization transcriptional regulator TreR, GntR family |
|
*
Streptococcus uberis 0140J Site: position = -104 score = 5.91518 sequence = CAAATTTGTAGGCAAGTTGT Gene: SUB1764: Trehalose utilization transcriptional regulator TreR, GntR family |
Trehalose utilization transcriptional regulator TreR, GntR family |
| CRON 2. | ||||||||||||||||
| treP |
|
|
Gene: SAG0192: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) |
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -128 score = 5.99604 sequence = ACAACTTGTAGACAAATTTG Gene: SDEG_2069: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) |
|
*
Streptococcus gallolyticus UCN34 Site: position = -99 score = 5.62441 sequence = ACAACTTGCAGACAAAATGG Gene: GALLO_2175: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) |
*
Streptococcus gordonii str. Challis substr. CH1 Site: position = -106 score = 5.40973 sequence = ACATCTTGCATACACGTTTG Gene: SGO_1653: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) |
|
*
Streptococcus mutans UA159 Site: position = -94 score = 5.62683 sequence = ACAACTTGCCAACAAATTTG Gene: SMU.2038: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) |
*
Streptococcus pneumoniae TIGR4 Site: position = -80 score = 5.80387 sequence = ACAAGTTGCAGACAAGTTTG Gene: SP_1884: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) |
*
Streptococcus pyogenes M1 GAS Site: position = -128 score = 5.99604 sequence = ACAACTTGTAGACAAATTTG Gene: SPy2097: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) |
*
Streptococcus sanguinis SK36 Site: position = -47 score = 5.51578 sequence = ACAACTTGCATACATCTTTG Gene: SSA_1752: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) |
Gene: SSU05_0231: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) |
|
*
Streptococcus uberis 0140J Site: position = -135 score = 5.91518 sequence = ACAACTTGCCTACAAATTTG Gene: SUB1763: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) |
Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) |
| treA |
|
|
Gene: SAG0193: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Gene: SDEG_2068: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
|
Gene: GALLO_2174: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Gene: SGO_1652: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
|
Gene: SMU.2037: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Gene: SP_1883: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Gene: SPy2096: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Gene: SSA_1751: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Gene: SSU05_0230: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
|
Gene: SUB1762: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |