Regulog PcaO - Corynebacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LuxR |
| Regulation mode: | activator |
| Biological process: | Protocatechuate degradation |
| Effector: | Protocatechuate |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Corynebacteriaceae
- By TF family - LuxR
- By effector - Protocatechuate
- By pathway - Protocatechuate degradation
| Genome | Genes | Operons |
|---|---|---|
| Corynebacterium amycolatum SK46 | ||
| Corynebacterium aurimucosum ATCC 700975 | ||
| Corynebacterium diphtheriae NCTC 13129 | ||
| Corynebacterium efficiens YS-314 | 4 | 1 |
| Corynebacterium glutamicum ATCC 13032 | 4 | 1 |
| Corynebacterium jeikeium K411 | ||
| Corynebacterium kroppenstedtii DSM 44385 | ||
| Corynebacterium urealyticum DSM 7109 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| pcaH |
|
|
|
*
Corynebacterium efficiens YS-314 Site: position = -127 score = 6.37725 sequence = ACCCCCAAAGCTGCTGGTGG Gene: CE2301: Protocatechuate 3,4-dioxygenase beta chain (EC 1.13.11.3) |
*
Corynebacterium glutamicum ATCC 13032 Site: position = -137 score = 6.37725 sequence = AACCCCTGACCTTCGGGGTT Gene: cg2631: Protocatechuate 3,4-dioxygenase beta chain (EC 1.13.11.3) |
|
|
|
Protocatechuate 3,4-dioxygenase beta chain (EC 1.13.11.3) |
| pcaG |
|
|
|
Gene: CE2300: Protocatechuate 3,4-dioxygenase alpha chain (EC 1.13.11.3) |
Gene: cg2630: Protocatechuate 3,4-dioxygenase alpha chain (EC 1.13.11.3) |
|
|
|
Protocatechuate 3,4-dioxygenase alpha chain (EC 1.13.11.3) |
| pcaB |
|
|
|
Gene: CE2299: 3-carboxy-cis,cis-muconate cycloisomerase (EC 5.5.1.2) |
Gene: cg2629: 3-carboxy-cis,cis-muconate cycloisomerase (EC 5.5.1.2) |
|
|
|
3-carboxy-cis,cis-muconate cycloisomerase (EC 5.5.1.2) |
| pcaC |
|
|
|
Gene: CE2298: 4-carboxymuconolactone decarboxylase (EC 4.1.1.44) |
Gene: cg2628: 4-carboxymuconolactone decarboxylase (EC 4.1.1.44) |
|
|
|
4-carboxymuconolactone decarboxylase (EC 4.1.1.44) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |