Regulog RutR2 - Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - RutR
- By taxonomy - Alteromonadales
- By TF family - TetR
- By effector - Uracil
- By pathway - Pyrimidine utilization
| Genome | Genes | Operons |
|---|---|---|
| Idiomarina loihiensis L2TR | ||
| Idiomarina baltica OS145 | ||
| Pseudoalteromonas tunicata D2 | ||
| Pseudoalteromonas haloplanktis TAC125 | ||
| Alteromonadales bacterium TW-7 | ||
| Colwellia psychrerythraea 34H | ||
| Glaciecola sp. HTCC2999 | ||
| Alteromonas macleodii 'Deep ecotype' | 8 | 2 |
| Pseudoalteromonas atlantica T6c |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| rutR2 |
|
|
|
|
|
|
|
*
Alteromonas macleodii 'Deep ecotype' Site: position = -139 score = 5.38566 sequence = AATGGACCTTTTGGTTCAAT Gene: MADE_00759: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
|
Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
| CRON 2. | ||||||||||
| rutA |
|
|
|
|
|
|
|
*
Alteromonas macleodii 'Deep ecotype' Site: position = -182 score = 5.38566 sequence = ATTGAACCAAAAGGTCCATT Gene: MADE_00760: Pyrimidine oxygenase |
|
Pyrimidine oxygenase |
| rutB |
|
|
|
|
|
|
|
Gene: MADE_00761: Peroxyureidoacrylate / ureidoacrylate amido hydrolase |
|
Peroxyureidoacrylate / ureidoacrylate amido hydrolase |
| rutC |
|
|
|
|
|
|
|
Gene: MADE_00762: Aminoacrylate peracid reductase |
|
Aminoacrylate peracid reductase |
| rutD |
|
|
|
|
|
|
|
Gene: MADE_00763: Aminoacrylate hydrolase |
|
Aminoacrylate hydrolase |
| rutE |
|
|
|
|
|
|
|
Gene: MADE_00764: 3-hydroxy propionic acid dehydrogenase |
|
3-hydroxy propionic acid dehydrogenase |
| rutF |
|
|
|
|
|
|
|
Gene: MADE_00765: Flavin reductase |
|
Flavin reductase |
| mmsA1 |
|
|
|
|
|
|
|
Gene: MADE_00766: methylmalonate-semialdehyde dehydrogenase |
|
Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |