Regulog XylR - Enterococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | ROK |
| Regulation mode: | repressor |
| Biological process: | Xylose utilization |
| Effector: | Xylose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - XylR
- By taxonomy - Enterococcaceae
- By TF family - ROK
- By effector - Xylose
- By pathway - Xylose utilization
| Genome | Genes | Operons |
|---|---|---|
| Enterococcus faecium DO | ||
| Enterococcus faecalis V583 | 8 | 2 |
| Genes | Function | ||
|---|---|---|---|
| CRON 1. | |||
| xylS |
|
*
Enterococcus faecalis V583 Site: position = -230 score = 6.06675 sequence = ATTAATTAGTTTAACGTGCTAAC Site: position = -158 score = 4.89887 sequence = GTTAATTAGTTTATCGTGAAAAC Gene: EF0551: Alpha-xylosidase (EC 3.2.1.-) |
Alpha-xylosidase (EC 3.2.1.-) |
| EF0552 |
|
Gene: EF0552: Phosphotransferase system for xylose-containing disaccharide, EIIC component |
Phosphotransferase system for xylose-containing disaccharide, EIIC component |
| EF0553 |
|
Gene: EF0553: Phosphotransferase system for xylose-containing disaccharide, EIID component |
Phosphotransferase system for xylose-containing disaccharide, EIID component |
| EF0554 |
|
Gene: EF0554: Phosphotransferase system for xylose-containing disaccharide, EIIB component |
Phosphotransferase system for xylose-containing disaccharide, EIIB component |
| EF0555 |
|
Gene: EF0555: Phosphotransferase system for xylose-containing disaccharide, EIIA component |
Phosphotransferase system for xylose-containing disaccharide, EIIA component |
| xylA |
|
Gene: EF0556: Xylose isomerase (EC 5.3.1.5) |
Xylose isomerase (EC 5.3.1.5) |
| xylB |
|
Gene: EF0557: Xylulose kinase (EC 2.7.1.17) |
Xylulose kinase (EC 2.7.1.17) |
| CRON 2. | |||
| xylR |
|
*
Enterococcus faecalis V583 Site: position = -231 score = 4.89887 sequence = GTTTTCACGATAAACTAATTAAC Site: position = -159 score = 6.06675 sequence = GTTAGCACGTTAAACTAATTAAT Gene: EF0550: Xylose repressor XylR, ROK family |
Xylose repressor XylR, ROK family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |