Regulog IscR - Xanthomonadales
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | activator (repressor) |
| Biological process: | Iron-sulfur cluster biogenesis |
| Effector: | Iron-sulfur cluster redox state |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Xanthomonadales
- By trascription factor - IscR
- By TF family - Rrf2
- By effector - Iron-sulfur cluster redox state
- By pathway - Iron-sulfur cluster biogenesis
| Genome | Genes | Operons |
|---|---|---|
| Xylella fastidiosa 9a5c | 5 | 1 |
| Xanthomonas axonopodis pv. citri str. 306 | 5 | 1 |
| Xanthomonas campestris pv. campestris str. ATCC 33913 | 5 | 1 |
| Stenotrophomonas maltophilia K279a | 6 | 1 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| iscR |
*
Xylella fastidiosa 9a5c Site: position = -45 score = 8.3157 sequence = AAAGCGTACAATTTCTGTCCGCTTT Gene: XF1477: Iron-sulfur cluster regulator IscR |
*
Xanthomonas axonopodis pv. citri str. 306 Site: position = -42 score = 8.41628 sequence = AAAGAGTACAATTTCGGTCCGCTTT Gene: XAC2934: Iron-sulfur cluster regulator IscR |
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -44 score = 8.41628 sequence = AAAGAGTACAATTTCGGTCCGCTTT Gene: XCC2765: Iron-sulfur cluster regulator IscR |
*
Stenotrophomonas maltophilia K279a Site: position = -44 score = 8.3157 sequence = AAAGCGTACAATTTCAGTCCGCTTT Gene: Smlt1158: Iron-sulfur cluster regulator IscR |
Iron-sulfur cluster regulator IscR |
| sufB |
Gene: XF1476: Iron-sulfur cluster assembly protein SufB |
Gene: XAC2935: Iron-sulfur cluster assembly protein SufB |
Gene: XCC2766: Iron-sulfur cluster assembly protein SufB |
Gene: Smlt1157: Iron-sulfur cluster assembly protein SufB |
Iron-sulfur cluster assembly protein SufB |
| Smlt1156 |
|
|
|
Gene: Smlt1156: hypothetical protein |
hypothetical protein |
| sufC |
Gene: XF1475: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: XAC2936: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: XCC2767: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: Smlt1155: Iron-sulfur cluster assembly ATPase protein SufC |
Iron-sulfur cluster assembly ATPase protein SufC |
| sufD |
Gene: XF1474: Iron-sulfur cluster assembly protein SufD |
Gene: XAC2937: Iron-sulfur cluster assembly protein SufD |
Gene: XCC2768: Iron-sulfur cluster assembly protein SufD |
Gene: Smlt1154: Iron-sulfur cluster assembly protein SufD |
Iron-sulfur cluster assembly protein SufD |
| sufS |
Gene: XF1473: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: XAC2938: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: XCC2769: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: Smlt1153: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |