Regulog IscR - Xanthomonadales

Properties
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Proteobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Statistics of regulated genes
Genome	Genes	Operons
Xylella fastidiosa 9a5c	5	1
Xanthomonas axonopodis pv. citri str. 306	5	1
Xanthomonas campestris pv. campestris str. ATCC 33913	5	1
Stenotrophomonas maltophilia K279a	6	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
iscR	* Xylella fastidiosa 9a5c Site: position = -45 score = 8.3157 sequence = AAAGCGTACAATTTCTGTCCGCTTT Gene: XF1477: Iron-sulfur cluster regulator IscR	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -42 score = 8.41628 sequence = AAAGAGTACAATTTCGGTCCGCTTT Gene: XAC2934: Iron-sulfur cluster regulator IscR	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -44 score = 8.41628 sequence = AAAGAGTACAATTTCGGTCCGCTTT Gene: XCC2765: Iron-sulfur cluster regulator IscR	* Stenotrophomonas maltophilia K279a Site: position = -44 score = 8.3157 sequence = AAAGCGTACAATTTCAGTCCGCTTT Gene: Smlt1158: Iron-sulfur cluster regulator IscR	Iron-sulfur cluster regulator IscR
sufB	Xylella fastidiosa 9a5c Gene: XF1476: Iron-sulfur cluster assembly protein SufB	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC2935: Iron-sulfur cluster assembly protein SufB	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC2766: Iron-sulfur cluster assembly protein SufB	Stenotrophomonas maltophilia K279a Gene: Smlt1157: Iron-sulfur cluster assembly protein SufB	Iron-sulfur cluster assembly protein SufB
Smlt1156	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	Stenotrophomonas maltophilia K279a Gene: Smlt1156: hypothetical protein	hypothetical protein
sufC	Xylella fastidiosa 9a5c Gene: XF1475: Iron-sulfur cluster assembly ATPase protein SufC	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC2936: Iron-sulfur cluster assembly ATPase protein SufC	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC2767: Iron-sulfur cluster assembly ATPase protein SufC	Stenotrophomonas maltophilia K279a Gene: Smlt1155: Iron-sulfur cluster assembly ATPase protein SufC	Iron-sulfur cluster assembly ATPase protein SufC
sufD	Xylella fastidiosa 9a5c Gene: XF1474: Iron-sulfur cluster assembly protein SufD	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC2937: Iron-sulfur cluster assembly protein SufD	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC2768: Iron-sulfur cluster assembly protein SufD	Stenotrophomonas maltophilia K279a Gene: Smlt1154: Iron-sulfur cluster assembly protein SufD	Iron-sulfur cluster assembly protein SufD
sufS	Xylella fastidiosa 9a5c Gene: XF1473: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC2938: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC2769: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Stenotrophomonas maltophilia K279a Gene: Smlt1153: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Cysteine desulfurase (EC 2.8.1.7), SufS subfamily

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog IscR - Xanthomonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --