Regulog HutC - Various betaproteobacteria
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Histidine utilization |
| Effector: | cis-Urocanic acid |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Various betaproteobacteria
- By trascription factor - HutC
- By TF family - GntR/Others
- By effector - cis-Urocanic acid
- By pathway - Histidine utilization
| Genome | Genes | Operons |
|---|---|---|
| Azoarcus sp. EbN1 | ||
| Thauera sp. MZ1T | ||
| Dechloromonas aromatica RCB | ||
| Nitrosomonas europaea ATCC 19718 | ||
| Nitrosospira multiformis ATCC 25196 | ||
| Thiobacillus denitrificans | ||
| Chromobacterium violaceum ATCC 12472 | 5 | 1 |
| Neisseria meningitidis MC58 | ||
| Laribacter hongkongensis HLHK9 | ||
| Methylobacillus flagellatus KT | ||
| Methylotenera mobilis JLW8 | ||
| Methylophilales bacterium HTCC2181 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| hutI |
Gene: ebA5740: Imidazolonepropionase (EC 3.5.2.7) |
|
|
|
|
|
*
Chromobacterium violaceum ATCC 12472 Site: position = -35 score = 4.69 sequence = TTAATTGTATATACAAATAA Site: position = -184 score = 4.09 sequence = TAAACGGTATATACAATTGG Gene: CV0321: Imidazolonepropionase (EC 3.5.2.7) |
|
|
|
|
|
Imidazolonepropionase (EC 3.5.2.7) |
| hutG2 |
Gene: ebA5739: Formiminoglutamase (EC 3.5.3.8) |
|
|
|
|
|
Gene: CV0322: Formiminoglutamase (EC 3.5.3.8) |
|
|
|
|
|
Formiminoglutamase (EC 3.5.3.8) |
| hutU |
Gene: ebA5741: Urocanate hydratase (EC 4.2.1.49) |
|
|
|
|
|
Gene: CV0323: Urocanate hydratase (EC 4.2.1.49) |
|
|
|
|
|
Urocanate hydratase (EC 4.2.1.49) |
| CV0324 |
|
|
|
|
|
|
Gene: CV0324: hypothetical protein |
|
|
|
|
|
hypothetical protein |
| hutH |
Gene: ebA5742: Histidine ammonia-lyase (EC 4.3.1.3) |
|
|
|
|
|
Gene: CV0325: Histidine ammonia-lyase (EC 4.3.1.3) |
|
|
|
|
|
Histidine ammonia-lyase (EC 4.3.1.3) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |