Statistics of regulated genes

Genome	Genes	Operons
Hahella chejuensis KCTC 2396	4	1
Marinobacter aqueolei
Marinobacter sp. ELB17
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Marinomonas sp. MWYL1	8	4
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107
Chromohalobacter salexigens DSM 3043
Reinekea sp. MED297	5	2
Alcanivorax borkumensis SK2

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes													Function
CRON 1.
COG3314	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	* Marinomonas sp. MWYL1 Site: position = -4 score = 5.1259 sequence = TAATATGTATATACATGTTG Site: position = -212 score = 4.04561 sequence = TGCTATGTATAGACAACCTT Gene: Mmwyl1_2465: Predicted histidine uptake transporter	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Predicted histidine uptake transporter
CRON 2.
hutF	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	* Marinomonas sp. MWYL1 Site: position = -65 score = 5.33992 sequence = ATACTTGTATATACATTATA Site: position = -249 score = 5.09554 sequence = GAACATGTATATACAATTAC Gene: Mmwyl1_3903: Formiminoglutamic iminohydrolase (EC 3.5.3.13)	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Formiminoglutamic iminohydrolase (EC 3.5.3.13)
hutD	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1 Gene: Mmwyl1_3904: protein related to histidine degradation	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	protein related to histidine degradation
CRON 3.
hutU	Hahella chejuensis KCTC 2396 Gene: HCH_04171: Urocanate hydratase (EC 4.2.1.49)	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	* Marinomonas sp. MWYL1 Site: position = -257 score = 5.58184 sequence = TATAATGTATATACAAGTAT Site: position = -73 score = 5.0836 sequence = GTAATTGTATATACATGTTC Gene: Mmwyl1_3902: Urocanate hydratase (EC 4.2.1.49)	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297 Gene: MED297_04894: Urocanate hydratase (EC 4.2.1.49)	Alcanivorax borkumensis SK2	Urocanate hydratase (EC 4.2.1.49)
hutH	Hahella chejuensis KCTC 2396 Gene: HCH_04172: Histidine ammonia-lyase (EC 4.3.1.3)	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1 Gene: Mmwyl1_3901: Histidine ammonia-lyase (EC 4.3.1.3)	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297 Gene: MED297_04889: Histidine ammonia-lyase (EC 4.3.1.3)	Alcanivorax borkumensis SK2	Histidine ammonia-lyase (EC 4.3.1.3)
hutI	* Hahella chejuensis KCTC 2396 Site: position = -47 score = 5.48426 sequence = TTAAATGTATATACATTTAT Site: position = -291 score = 5.61401 sequence = AAATTTGTATATACATTCAA Gene: HCH_04169: Imidazolonepropionase (EC 3.5.2.7)	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1 Gene: Mmwyl1_3900: Imidazolonepropionase (EC 3.5.2.7)	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	* Reinekea sp. MED297 Site: position = -35 score = 5.39876 sequence = CAAGTTGTATATACAACTAA Gene: MED297_04904: Imidazolonepropionase (EC 3.5.2.7)	Alcanivorax borkumensis SK2	Imidazolonepropionase (EC 3.5.2.7)
hutG	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1 Gene: Mmwyl1_3899: N-formylglutamate deformylase (EC 3.5.1.68)	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	N-formylglutamate deformylase (EC 3.5.1.68)
hutG2	Hahella chejuensis KCTC 2396 Gene: HCH_04170: Formiminoglutamase (EC 3.5.3.8)	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297 Gene: MED297_04909: Formiminoglutamase (EC 3.5.3.8)	Alcanivorax borkumensis SK2	Formiminoglutamase (EC 3.5.3.8)
hutC	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	* Marinomonas sp. MWYL1 Site: position = -73 score = 4.52478 sequence = CTAGATGTATAGACAAGTTG Gene: Mmwyl1_3905: Histidine utilization repressor, GntR family	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	* Reinekea sp. MED297 Site: position = -52 score = 5.2028 sequence = TTAGTTGTATATACAACTTG Gene: MED297_04899: Histidine utilization repressor, GntR family	Alcanivorax borkumensis SK2	Histidine utilization repressor, GntR family

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD