Regulog HutC - Oceanospirillales/Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Histidine utilization |
| Effector: | cis-Urocanic acid |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By trascription factor - HutC
- By TF family - GntR/Others
- By effector - cis-Urocanic acid
- By pathway - Histidine utilization
| Genome | Genes | Operons |
|---|---|---|
| Hahella chejuensis KCTC 2396 | 4 | 1 |
| Marinobacter aqueolei | ||
| Marinobacter sp. ELB17 | ||
| Oceanobacter sp. RED65 | ||
| Oceanospirillum sp. MED92 | ||
| Marinomonas sp. MWYL1 | 8 | 4 |
| Saccharophagus degradans 2-40 | ||
| Teredinibacter turnerae T7901 | ||
| Cellvibrio japonicus Ueda107 | ||
| Chromohalobacter salexigens DSM 3043 | ||
| Reinekea sp. MED297 | 5 | 2 |
| Alcanivorax borkumensis SK2 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| COG3314 |
|
|
|
|
|
*
Marinomonas sp. MWYL1 Site: position = -4 score = 5.1259 sequence = TAATATGTATATACATGTTG Site: position = -212 score = 4.04561 sequence = TGCTATGTATAGACAACCTT Gene: Mmwyl1_2465: Predicted histidine uptake transporter |
|
|
|
|
|
|
Predicted histidine uptake transporter |
| CRON 2. | |||||||||||||
| hutF |
|
|
|
|
|
*
Marinomonas sp. MWYL1 Site: position = -65 score = 5.33992 sequence = ATACTTGTATATACATTATA Site: position = -249 score = 5.09554 sequence = GAACATGTATATACAATTAC Gene: Mmwyl1_3903: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
|
|
|
|
|
|
Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
| hutD |
|
|
|
|
|
Gene: Mmwyl1_3904: protein related to histidine degradation |
|
|
|
|
|
|
protein related to histidine degradation |
| CRON 3. | |||||||||||||
| hutU |
Gene: HCH_04171: Urocanate hydratase (EC 4.2.1.49) |
|
|
|
|
*
Marinomonas sp. MWYL1 Site: position = -257 score = 5.58184 sequence = TATAATGTATATACAAGTAT Site: position = -73 score = 5.0836 sequence = GTAATTGTATATACATGTTC Gene: Mmwyl1_3902: Urocanate hydratase (EC 4.2.1.49) |
|
|
|
|
Gene: MED297_04894: Urocanate hydratase (EC 4.2.1.49) |
|
Urocanate hydratase (EC 4.2.1.49) |
| hutH |
Gene: HCH_04172: Histidine ammonia-lyase (EC 4.3.1.3) |
|
|
|
|
Gene: Mmwyl1_3901: Histidine ammonia-lyase (EC 4.3.1.3) |
|
|
|
|
Gene: MED297_04889: Histidine ammonia-lyase (EC 4.3.1.3) |
|
Histidine ammonia-lyase (EC 4.3.1.3) |
| hutI |
*
Hahella chejuensis KCTC 2396 Site: position = -47 score = 5.48426 sequence = TTAAATGTATATACATTTAT Site: position = -291 score = 5.61401 sequence = AAATTTGTATATACATTCAA Gene: HCH_04169: Imidazolonepropionase (EC 3.5.2.7) |
|
|
|
|
Gene: Mmwyl1_3900: Imidazolonepropionase (EC 3.5.2.7) |
|
|
|
|
*
Reinekea sp. MED297 Site: position = -35 score = 5.39876 sequence = CAAGTTGTATATACAACTAA Gene: MED297_04904: Imidazolonepropionase (EC 3.5.2.7) |
|
Imidazolonepropionase (EC 3.5.2.7) |
| hutG |
|
|
|
|
|
Gene: Mmwyl1_3899: N-formylglutamate deformylase (EC 3.5.1.68) |
|
|
|
|
|
|
N-formylglutamate deformylase (EC 3.5.1.68) |
| hutG2 |
Gene: HCH_04170: Formiminoglutamase (EC 3.5.3.8) |
|
|
|
|
|
|
|
|
|
Gene: MED297_04909: Formiminoglutamase (EC 3.5.3.8) |
|
Formiminoglutamase (EC 3.5.3.8) |
| hutC |
|
|
|
|
|
*
Marinomonas sp. MWYL1 Site: position = -73 score = 4.52478 sequence = CTAGATGTATAGACAAGTTG Gene: Mmwyl1_3905: Histidine utilization repressor, GntR family |
|
|
|
|
*
Reinekea sp. MED297 Site: position = -52 score = 5.2028 sequence = TTAGTTGTATATACAACTTG Gene: MED297_04899: Histidine utilization repressor, GntR family |
|
Histidine utilization repressor, GntR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |