Regulog NrtR - Oceanospirillales/Alteromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Statistics of regulated genes
Genome	Genes	Operons
Hahella chejuensis KCTC 2396	7	4
Marinobacter aqueolei
Marinobacter sp. ELB17	5	2
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Marinomonas sp. MWYL1
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107
Chromohalobacter salexigens DSM 3043
Reinekea sp. MED297
Alcanivorax borkumensis SK2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes													Function

CRON 1.
nrtR	* Hahella chejuensis KCTC 2396 Site: position = -41 score = 5.98504 sequence = TTAGTGGCCTAATGCCACTAA Gene: HCH_06996: Nudix-related transcriptional regulator NrtR	Marinobacter aqueolei	* Marinobacter sp. ELB17 Site: position = -73 score = 4.71508 sequence = TGTGTCAATTGATTTGACAGA Site: position = -116 score = 4.51655 sequence = TTAGTCAATTCATTTGACGGT Gene: MELB17_12281: Nudix-related transcriptional regulator NrtR	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Nudix-related transcriptional regulator NrtR

CRON 2.
nrtX	* Hahella chejuensis KCTC 2396 Site: position = -46 score = 5.61695 sequence = TTGGTGGCTTTGAGCCACTAT Gene: HCH_04328: NrtR-regulated hypothetical OrfX, Band 7 protein domain	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	NrtR-regulated hypothetical OrfX, Band 7 protein domain
nrtY	Hahella chejuensis KCTC 2396 Gene: HCH_04327: NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain

CRON 3.
nadM	* Hahella chejuensis KCTC 2396 Site: position = -126 score = 6.04466 sequence = TTAGTGTCATTATGCCACTAT Gene: HCH_06993: Nicotinamide-nucleotide adenylyltransferase, NadM family (EC 2.7.7.1) / ADP-ribose pyrophosphatase (EC 3.6.1.13)	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Nicotinamide-nucleotide adenylyltransferase, NadM family (EC 2.7.7.1) / ADP-ribose pyrophosphatase (EC 3.6.1.13)
nadV	Hahella chejuensis KCTC 2396 Gene: HCH_06992: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)

CRON 4.
pnuC	* Hahella chejuensis KCTC 2396 Site: position = -103 score = 6.17106 sequence = TTAGTGGCATTAGGCCACTAA Gene: HCH_06995: Ribosyl nicotinamide transporter, PnuC-like	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Ribosyl nicotinamide transporter, PnuC-like
nadR	Hahella chejuensis KCTC 2396 Gene: HCH_06994: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22)	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22)

CRON 5.
pncB	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	* Marinobacter sp. ELB17 Site: position = -75 score = 4.71508 sequence = TCTGTCAAATCAATTGACACA Gene: MELB17_12286: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
nadE	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17 Gene: MELB17_12291: NAD synthetase (EC 6.3.1.5)	Oceanobacter sp. RED65	Oceanospirillum sp. MED92 Gene: MED92_18213: NAD synthetase (EC 6.3.1.5)	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297 Gene: MED297_04869: NAD synthetase (EC 6.3.1.5)	Alcanivorax borkumensis SK2	NAD synthetase (EC 6.3.1.5)
pncA	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17 Gene: MELB17_12296: Nicotinamidase (EC 3.5.1.19)	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043 Gene: Csal_2870: Nicotinamidase (EC 3.5.1.19)	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Nicotinamidase (EC 3.5.1.19)
nadD	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17 Gene: MELB17_12301: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog NrtR - Oceanospirillales/Alteromonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --