Regulog NsrR - Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | repressor |
| Biological process: | Nitrosative stress response |
| Effector: | Nitric oxide |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Alteromonadales
- By trascription factor - NsrR
- By TF family - Rrf2
- By effector - Nitric oxide
- By pathway - Nitrosative stress response
| Genome | Genes | Operons |
|---|---|---|
| Pseudoalteromonas atlantica T6c | ||
| Alteromonas macleodii 'Deep ecotype' | ||
| Glaciecola sp. HTCC2999 | ||
| Colwellia psychrerythraea 34H | ||
| Alteromonadales bacterium TW-7 | ||
| Pseudoalteromonas haloplanktis TAC125 | 2 | 2 |
| Pseudoalteromonas tunicata D2 | ||
| Idiomarina baltica OS145 | ||
| Idiomarina loihiensis L2TR |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| norB |
|
|
|
|
|
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -191 score = 5.41907 sequence = ACATGCATTTTGTTTGCATGT Gene: PSHAa2417: Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent |
|
|
Gene: IL0186: Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent |
Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent |
| CRON 2. | ||||||||||
| nsrR |
|
|
|
|
|
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -132 score = 5.41907 sequence = ACATGCAAACAAAATGCATGT Gene: PSHAa2419: Rrf2 family nitrosative stress transcriptional regulator, NO-sensitive |
|
|
|
Rrf2 family nitrosative stress transcriptional regulator, NO-sensitive |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |