Regulog DctR - Bacillales

Properties
Regulator type:	Transcription factor
Regulator family:	OmpR
Regulation mode:	repressor
Biological process:	C4-dicarboxylate transport
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Bacillus subtilis subsp. subtilis str. 168	1	1
Bacillus amyloliquefaciens FZB42	1	1
Bacillus pumilus SAFR-032	1	1
Bacillus licheniformis DSM 13
Anoxybacillus flavithermus WK1
Geobacillus kaustophilus HTA426	1	1
Bacillus cereus ATCC 14579
Bacillus halodurans C-125
Bacillus clausii KSM-K16
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
dctA	* Bacillus subtilis subsp. subtilis str. 168 Site: position = -115 score = 4.2802 sequence = AGACCAAAAAGACCAAAATGTCCGTTATGATCATAA Gene: BSU04470: C4-dicarboxylate transporter for succinate, fumurate, malate and oxaloacetate	* Bacillus amyloliquefaciens FZB42 Site: position = -105 score = 4.2802 sequence = AGACCAAAAAGACCAAAATGTCCGTTATGATCATAA Gene: RBAM_004800: C4-dicarboxylate transporter for succinate, fumurate, malate and oxaloacetate	* Bacillus pumilus SAFR-032 Site: position = -123 score = 4.2802 sequence = AGACCAAAAAGACCAAAATGTACGATATGTACATAA Gene: BPUM_0419: C4-dicarboxylate transporter for succinate, fumurate, malate and oxaloacetate	Bacillus licheniformis DSM 13	Anoxybacillus flavithermus WK1	* Geobacillus kaustophilus HTA426 Site: position = 71 score = 4.2802 sequence = AGACCAAAAAGACCAAAACGACCATTATCACCATAA Gene: GK0561: C4-dicarboxylate transporter for succinate, fumurate, malate and oxaloacetate	Bacillus cereus ATCC 14579	Bacillus halodurans C-125	Bacillus clausii KSM-K16	Oceanobacillus iheyensis HTE831	Paenibacillus sp. JDR-2	C4-dicarboxylate transporter for succinate, fumurate, malate and oxaloacetate

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --