Regulon of DctR in Bacillus amyloliquefaciens FZB42

Properties
Regulator type:	Transcription factor
TF locus tag:	RBAM_004790
Regulator family:	OmpR
Regulation mode:	repressor
Biological process:	C4-dicarboxylate transport
Effector:
Regulog:	DctR - Bacillales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - OmpR
By pathway - C4-dicarboxylate transport

Regulated operons
	Locus Tag	Name	Function
Position: -105 Score: 4.3 Sequence: AGACCAAAAAGACCAAAATGTCCGTTATGATCATAA Locus tag: RBAM_004800 Name: dctA Funciton: C4-dicarboxylate transporter for succinate, fumurate, malate and oxaloacetate
	RBAM_004800	dctA	C4-dicarboxylate transporter for succinate, fumurate, malate and oxaloacetate

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD