Regulon of DctR in Bacillus subtilis subsp. subtilis str. 168
| Regulator type: | Transcription factor |
| TF locus tag: | BSU04460 |
| Regulator family: | OmpR |
| Regulation mode: | repressor |
| Biological process: | C4-dicarboxylate transport |
| Effector: | |
| Regulog: | DctR - Bacillales |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - OmpR
- By pathway - C4-dicarboxylate transport
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -115
Score: 4.3 Sequence: AGACCAAAAAGACCAAAATGTCCGTTATGATCATAA
Locus tag: BSU04470
Name: dctA Funciton: C4-dicarboxylate transporter for succinate, fumurate, malate and oxaloacetate |
|||
|
dctA
|
C4-dicarboxylate transporter for succinate, fumurate, malate and oxaloacetate
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |