Regulog SufR - Cyanobacteria
| Regulator type: | Transcription factor |
| Regulator family: | [Other] |
| Regulation mode: | repressor |
| Biological process: | Iron-sulfur cluster biogenesis |
| Effector: | Iron-sulfur cluster redox state |
| Phylum: | Cyanobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Cyanobacteria
- By TF family - [Other]
- By effector - Iron-sulfur cluster redox state
- By pathway - Iron-sulfur cluster biogenesis
| Genome | Genes | Operons |
|---|---|---|
| Synechococcus sp. PCC 7002 | 6 | 3 |
| Synechocystis sp. PCC 6803 | 6 | 3 |
| Cyanothece sp. ATCC 51142 | 6 | 4 |
| Cyanothece sp. PCC 8801 | 6 | 3 |
| Cyanothece sp. PCC 7425 | 10 | 2 |
| Microcystis aeruginosa NIES-843 | 5 | 2 |
| Nostoc sp. PCC 7120 | 5 | 2 |
| Trichodesmium erythraeum IMS101 | 5 | 2 |
| Synechococcus elongatus PCC 7942 | 6 | 2 |
| Prochlorococcus marinus str. MIT 9313 | 5 | 2 |
| Synechococcus sp. JA-3-3Ab | 2 | 2 |
| Synechococcus sp. WH 8102 | 6 | 2 |
| Gloeobacter violaceus PCC 7421 | ||
| Thermosynechococcus elongatus BP-1 | 2 | 2 |
| Genes | Function | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||
| sufB |
*
Synechococcus sp. PCC 7002 Site: position = -145 score = 5.24215 sequence = TTTGACAACTTTTTTGTTGTTAAA Site: position = -104 score = 5.56969 sequence = TAAAACAACCAAACAGTTGTTAAA Gene: SYNPCC7002_A1814: Iron-sulfur assembly protein |
*
Synechocystis sp. PCC 6803 Site: position = -116 score = 5.31695 sequence = TAAAACAACTTACCTGTTGTTTTA Gene: slr0074: Iron-sulfur assembly protein |
*
Cyanothece sp. ATCC 51142 Site: position = -155 score = 4.75697 sequence = TTTGACAACAATTGAGTTGTTAAT Site: position = -115 score = 5.83461 sequence = TAAAGAAACATAAATGTTGTTTTA Gene: cce_0685: Iron-sulfur assembly protein |
*
Cyanothece sp. PCC 8801 Site: position = -188 score = 4.8096 sequence = TTTGACAACAATGGGGTTGTTATT Site: position = -148 score = 5.85691 sequence = TTGAGCAACAAAAATGTTGTTTAA Gene: PCC8801_0415: Iron-sulfur assembly protein |
*
Cyanothece sp. PCC 7425 Site: position = -106 score = 5.00114 sequence = TTAGACAACTGATGTGTTGCTAAA Site: position = -67 score = 5.33647 sequence = TTAAGCAACGCCTGAGTTGTTTAA Gene: Cyan7425_3450: Iron-sulfur assembly protein |
*
Microcystis aeruginosa NIES-843 Site: position = -105 score = 5.10361 sequence = TTTGACAACAGCTTTGTTGTTAAT Site: position = -65 score = 5.87571 sequence = TTAAACAACTTTATTGTTGTTTAA Gene: MAE_23090: Iron-sulfur assembly protein |
*
Nostoc sp. PCC 7120 Site: position = -193 score = 5.17528 sequence = TTTGACAACATTGTTGTTGTTAAT Site: position = -148 score = 6.0379 sequence = TTAAACAACATCGATGTTGTTTTA Gene: alr2492: Iron-sulfur assembly protein |
*
Trichodesmium erythraeum IMS101 Site: position = -62 score = 6.04928 sequence = TTAAACAACAAATAAGTTGTTTAA Gene: Tery_4355: Iron-sulfur assembly protein |
Gene: Synpcc7942_1735: Iron-sulfur assembly protein |
*
Prochlorococcus marinus str. MIT 9313 Site: position = -194 score = 5.00624 sequence = AAACGAAACCAATAGGTTTCGTTT Gene: PMT1606: Iron-sulfur assembly protein |
*
Synechococcus sp. JA-3-3Ab Site: position = -67 score = 5.33468 sequence = TTAAGCAACAACCGTGTTGTTTTA Gene: CYA_2190: Iron-sulfur assembly protein |
Gene: SYNW0319: Iron-sulfur assembly protein |
Gene: gvip196: Iron-sulfur assembly protein |
*
Thermosynechococcus elongatus BP-1 Site: position = -116 score = 5.50114 sequence = TAAAACAACCGTTTTGTTGCTAAA Site: position = -78 score = 5.2042 sequence = TAAAGCAACCATCTCGTTGCTTAA Gene: null: Iron-sulfur assembly protein |
Iron-sulfur assembly protein |
| Cyan7425_3449 |
|
|
|
|
Gene: Cyan7425_3449: Hypothetical protein |
|
|
|
|
|
|
|
|
|
Hypothetical protein |
| Cyan7425_3448 |
|
|
|
|
Gene: Cyan7425_3448: Hypothetical protein |
|
|
|
|
|
|
|
|
|
Hypothetical protein |
| Cyan7425_3447 |
|
|
|
|
Gene: Cyan7425_3447: Hypothetical protein |
|
|
|
|
|
|
|
|
|
Hypothetical protein |
| Cyan7425_3446 |
Gene: SYNPCC7002_F0040: Predicted oxoglutarate/iron-dependent oxygenase |
|
|
|
Gene: Cyan7425_3446: Predicted oxoglutarate/iron-dependent oxygenase |
|
|
|
|
|
|
|
|
|
Predicted oxoglutarate/iron-dependent oxygenase |
| Cyan7425_3445 |
|
|
|
Gene: PCC8801_0218: Conserved hypothetical protein |
Gene: Cyan7425_3445: Conserved hypothetical protein |
Gene: MAE_21360: Conserved hypothetical protein |
|
|
|
|
|
|
|
|
Conserved hypothetical protein |
| sufC |
Gene: SYNPCC7002_A1813: Iron-sulfur assembly ATPase |
Gene: slr0075: Iron-sulfur assembly ATPase |
Gene: cce_0686: Iron-sulfur assembly ATPase |
Gene: PCC8801_0416: Iron-sulfur assembly ATPase |
Gene: Cyan7425_3444: Iron-sulfur assembly ATPase |
Gene: MAE_23080: Iron-sulfur assembly ATPase |
Gene: alr2493: Iron-sulfur assembly ATPase |
Gene: Tery_4356: Iron-sulfur assembly ATPase |
Gene: Synpcc7942_1736: Iron-sulfur assembly ATPase |
Gene: PMT1605: Iron-sulfur assembly ATPase |
Gene: CYA_2193: Iron-sulfur assembly ATPase |
Gene: SYNW0320: Iron-sulfur assembly ATPase |
Gene: glr1371: Iron-sulfur assembly ATPase |
Gene: tlr1904: Iron-sulfur assembly ATPase |
Iron-sulfur assembly ATPase |
| sufD |
Gene: SYNPCC7002_A1812: Iron-sulfur assembly protein |
Gene: slr0076: Iron-sulfur assembly protein |
*
Cyanothece sp. ATCC 51142 Site: position = -137 score = 5.81499 sequence = TTTAACAACATTTTTGTTGCTAAA Gene: cce_1005: Iron-sulfur assembly protein |
Gene: PCC8801_0417: Iron-sulfur assembly protein |
Gene: Cyan7425_3443: Iron-sulfur assembly protein |
Gene: MAE_23070: Iron-sulfur assembly protein |
Gene: alr2494: Iron-sulfur assembly protein |
Gene: Tery_4357: Iron-sulfur assembly protein |
Gene: Synpcc7942_1737: Iron-sulfur assembly protein |
Gene: PMT1604: Iron-sulfur assembly protein |
Gene: CYA_2194: Iron-sulfur assembly protein |
Gene: SYNW0321: Iron-sulfur assembly protein |
Gene: glr1372: Iron-sulfur assembly protein |
Gene: tlr1905: Iron-sulfur assembly protein |
Iron-sulfur assembly protein |
| sufS |
Gene: SYNPCC7002_A1811: Cysteine desulfurase (EC 2.8.1.7) |
Gene: slr0077: Cysteine desulfurase (EC 2.8.1.7) |
Gene: cce_1004: Cysteine desulfurase (EC 2.8.1.7) |
Gene: PCC8801_0418: Cysteine desulfurase (EC 2.8.1.7) |
Gene: Cyan7425_3442: Cysteine desulfurase (EC 2.8.1.7) |
Gene: MAE_23060: Cysteine desulfurase (EC 2.8.1.7) |
Gene: alr2495: Cysteine desulfurase (EC 2.8.1.7) |
Gene: Tery_4358: Cysteine desulfurase (EC 2.8.1.7) |
Gene: Synpcc7942_1738: Cysteine desulfurase (EC 2.8.1.7) |
Gene: PMT1603: Cysteine desulfurase (EC 2.8.1.7) |
Gene: CYA_0391: Cysteine desulfurase (EC 2.8.1.7) |
Gene: SYNW0322: Cysteine desulfurase (EC 2.8.1.7) |
Gene: glr1373: Cysteine desulfurase (EC 2.8.1.7) |
Gene: null: Cysteine desulfurase (EC 2.8.1.7) |
Cysteine desulfurase (EC 2.8.1.7) |
| ftrC |
|
|
|
|
|
|
|
|
*
Synechococcus elongatus PCC 7942 Site: position = -101 score = 5.13968 sequence = TTTGACAACATTGATGTTGTTCAA Site: position = -63 score = 5.06048 sequence = TTAAGCAACGTCTGTGTTGTTCAA Gene: Synpcc7942_1734: Ferredoxin thioredoxin reductase catalytic chain |
|
|
*
Synechococcus sp. WH 8102 Site: position = -39 score = 4.85631 sequence = TAAGGAAACCAGGTCGTTTCGTAA Gene: SYNW0318: Ferredoxin thioredoxin reductase catalytic chain |
|
|
Ferredoxin thioredoxin reductase catalytic chain |
| CRON 2. | |||||||||||||||
| sufR |
*
Synechococcus sp. PCC 7002 Site: position = -39 score = 5.78826 sequence = TTTAACAACAAAAAAGTTGTCAAA Site: position = -80 score = 5.54478 sequence = TTTAACAACTGTTTGGTTGTTTTA Gene: SYNPCC7002_A1815: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria |
*
Synechocystis sp. PCC 6803 Site: position = -163 score = 5.56626 sequence = TAAAACAACAGGTAAGTTGTTTTA Site: position = -123 score = 5.61869 sequence = ATTAGCAACCCGATTGTTGTCAAA Gene: sll0088: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria |
*
Cyanothece sp. ATCC 51142 Site: position = -109 score = 5.69064 sequence = ATTAACAACTCAATTGTTGTCAAA Site: position = -149 score = 5.74771 sequence = TAAAACAACATTTATGTTTCTTTA Gene: cce_0683: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria |
*
Cyanothece sp. PCC 8801 Site: position = -160 score = 5.57277 sequence = AATAACAACCCCATTGTTGTCAAA Site: position = -200 score = 5.67787 sequence = TTAAACAACATTTTTGTTGCTCAA Gene: PCC8801_0414: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria |
*
Cyanothece sp. PCC 7425 Site: position = -74 score = 5.83418 sequence = TTTAGCAACACATCAGTTGTCTAA Site: position = -113 score = 5.54276 sequence = TTAAACAACTCAGGCGTTGCTTAA Gene: Cyan7425_3451: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria |
*
Microcystis aeruginosa NIES-843 Site: position = -182 score = 5.89491 sequence = TTAAACAACAATAAAGTTGTTTAA Site: position = -142 score = 5.68911 sequence = ATTAACAACAAAGCTGTTGTCAAA Gene: MAE_23100: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria |
*
Nostoc sp. PCC 7120 Site: position = -101 score = 5.94534 sequence = TAAAACAACATCGATGTTGTTTAA Site: position = -56 score = 5.74124 sequence = ATTAACAACAACAATGTTGTCAAA Gene: all2491: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria |
*
Trichodesmium erythraeum IMS101 Site: position = -212 score = 6.03008 sequence = TTAAACAACTTATTTGTTGTTTAA Gene: Tery_4354: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria |
*
Synechococcus elongatus PCC 7942 Site: position = -98 score = 5.65463 sequence = TTGAACAACATCAATGTTGTCAAA Site: position = -136 score = 5.72133 sequence = TTGAACAACACAGACGTTGCTTAA Gene: Synpcc7942_1733: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria |
*
Prochlorococcus marinus str. MIT 9313 Site: position = -204 score = 5.03297 sequence = AAACGAAACCTATTGGTTTCGTTT Gene: PMT1607: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria |
*
Synechococcus sp. JA-3-3Ab Site: position = -119 score = 5.95767 sequence = TAAAACAACACGGTTGTTGCTTAA Gene: CYA_2189: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria |
*
Synechococcus sp. WH 8102 Site: position = -68 score = 4.87451 sequence = TTACGAAACGACCTGGTTTCCTTA Gene: SYNW0317: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria |
|
*
Thermosynechococcus elongatus BP-1 Site: position = -40 score = 5.89961 sequence = TTTAGCAACAAAACGGTTGTTTTA Site: position = -78 score = 5.65142 sequence = TTAAGCAACGAGATGGTTGCTTTA Gene: tlr0491: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria |
Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria |
| CRON 3. | |||||||||||||||
| nifJ |
*
Synechococcus sp. PCC 7002 Site: position = -152 score = 5.11538 sequence = TTTAGCAAGCATTTTGTTGTTAAA Gene: SYNPCC7002_A1443: Pyruvate oxidoreductase |
*
Synechocystis sp. PCC 6803 Site: position = -172 score = 4.92307 sequence = AAAAACAATCTTGACGTTGTTTAA Gene: sll0741: Pyruvate oxidoreductase |
*
Cyanothece sp. ATCC 51142 Site: position = -133 score = 5.56327 sequence = AAAAACAACCCTAATGTTGTGTTA Gene: cce_0953: Pyruvate oxidoreductase |
*
Cyanothece sp. PCC 8801 Site: position = -134 score = 5.46903 sequence = AAAAACAACCATGAAGTTGTCTTA Gene: PCC8801_3918: Pyruvate oxidoreductase |
Gene: Cyan7425_4369: Pyruvate oxidoreductase |
Gene: MAE_38140: Pyruvate oxidoreductase |
2
Nostoc sp. PCC 7120 Gene: alr2803: Pyruvate oxidoreductase Gene: alr1911: Pyruvate oxidoreductase |
|
Gene: Synpcc7942_2384: Pyruvate oxidoreductase |
|
|
|
|
|
Pyruvate oxidoreductase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |