Regulog SufR - Cyanobacteria

Properties
Regulator type:	Transcription factor
Regulator family:	[Other]
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Cyanobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 48 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By TF family - [Other]
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Statistics of regulated genes
Genome	Genes	Operons
Synechococcus sp. PCC 7002	6	3
Synechocystis sp. PCC 6803	6	3
Cyanothece sp. ATCC 51142	6	4
Cyanothece sp. PCC 8801	6	3
Cyanothece sp. PCC 7425	10	2
Microcystis aeruginosa NIES-843	5	2
Nostoc sp. PCC 7120	5	2
Trichodesmium erythraeum IMS101	5	2
Synechococcus elongatus PCC 7942	6	2
Prochlorococcus marinus str. MIT 9313	5	2
Synechococcus sp. JA-3-3Ab	2	2
Synechococcus sp. WH 8102	6	2
Gloeobacter violaceus PCC 7421
Thermosynechococcus elongatus BP-1	2	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes															Function

CRON 1.
sufB	* Synechococcus sp. PCC 7002 Site: position = -145 score = 5.24215 sequence = TTTGACAACTTTTTTGTTGTTAAA Site: position = -104 score = 5.56969 sequence = TAAAACAACCAAACAGTTGTTAAA Gene: SYNPCC7002_A1814: Iron-sulfur assembly protein	* Synechocystis sp. PCC 6803 Site: position = -116 score = 5.31695 sequence = TAAAACAACTTACCTGTTGTTTTA Gene: slr0074: Iron-sulfur assembly protein	* Cyanothece sp. ATCC 51142 Site: position = -155 score = 4.75697 sequence = TTTGACAACAATTGAGTTGTTAAT Site: position = -115 score = 5.83461 sequence = TAAAGAAACATAAATGTTGTTTTA Gene: cce_0685: Iron-sulfur assembly protein	* Cyanothece sp. PCC 8801 Site: position = -188 score = 4.8096 sequence = TTTGACAACAATGGGGTTGTTATT Site: position = -148 score = 5.85691 sequence = TTGAGCAACAAAAATGTTGTTTAA Gene: PCC8801_0415: Iron-sulfur assembly protein	* Cyanothece sp. PCC 7425 Site: position = -106 score = 5.00114 sequence = TTAGACAACTGATGTGTTGCTAAA Site: position = -67 score = 5.33647 sequence = TTAAGCAACGCCTGAGTTGTTTAA Gene: Cyan7425_3450: Iron-sulfur assembly protein	* Microcystis aeruginosa NIES-843 Site: position = -105 score = 5.10361 sequence = TTTGACAACAGCTTTGTTGTTAAT Site: position = -65 score = 5.87571 sequence = TTAAACAACTTTATTGTTGTTTAA Gene: MAE_23090: Iron-sulfur assembly protein	* Nostoc sp. PCC 7120 Site: position = -193 score = 5.17528 sequence = TTTGACAACATTGTTGTTGTTAAT Site: position = -148 score = 6.0379 sequence = TTAAACAACATCGATGTTGTTTTA Gene: alr2492: Iron-sulfur assembly protein	* Trichodesmium erythraeum IMS101 Site: position = -62 score = 6.04928 sequence = TTAAACAACAAATAAGTTGTTTAA Gene: Tery_4355: Iron-sulfur assembly protein	Synechococcus elongatus PCC 7942 Gene: Synpcc7942_1735: Iron-sulfur assembly protein	* Prochlorococcus marinus str. MIT 9313 Site: position = -194 score = 5.00624 sequence = AAACGAAACCAATAGGTTTCGTTT Gene: PMT1606: Iron-sulfur assembly protein	* Synechococcus sp. JA-3-3Ab Site: position = -67 score = 5.33468 sequence = TTAAGCAACAACCGTGTTGTTTTA Gene: CYA_2190: Iron-sulfur assembly protein	Synechococcus sp. WH 8102 Gene: SYNW0319: Iron-sulfur assembly protein	Gloeobacter violaceus PCC 7421 Gene: gvip196: Iron-sulfur assembly protein	* Thermosynechococcus elongatus BP-1 Site: position = -116 score = 5.50114 sequence = TAAAACAACCGTTTTGTTGCTAAA Site: position = -78 score = 5.2042 sequence = TAAAGCAACCATCTCGTTGCTTAA Gene: null: Iron-sulfur assembly protein	Iron-sulfur assembly protein
Cyan7425_3449	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425 Gene: Cyan7425_3449: Hypothetical protein	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	Hypothetical protein
Cyan7425_3448	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425 Gene: Cyan7425_3448: Hypothetical protein	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	Hypothetical protein
Cyan7425_3447	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425 Gene: Cyan7425_3447: Hypothetical protein	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	Hypothetical protein
Cyan7425_3446	Synechococcus sp. PCC 7002 Gene: SYNPCC7002_F0040: Predicted oxoglutarate/iron-dependent oxygenase	Synechocystis sp. PCC 6803	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425 Gene: Cyan7425_3446: Predicted oxoglutarate/iron-dependent oxygenase	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	Predicted oxoglutarate/iron-dependent oxygenase
Cyan7425_3445	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 8801 Gene: PCC8801_0218: Conserved hypothetical protein	Cyanothece sp. PCC 7425 Gene: Cyan7425_3445: Conserved hypothetical protein	Microcystis aeruginosa NIES-843 Gene: MAE_21360: Conserved hypothetical protein	Nostoc sp. PCC 7120	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	Conserved hypothetical protein
sufC	Synechococcus sp. PCC 7002 Gene: SYNPCC7002_A1813: Iron-sulfur assembly ATPase	Synechocystis sp. PCC 6803 Gene: slr0075: Iron-sulfur assembly ATPase	Cyanothece sp. ATCC 51142 Gene: cce_0686: Iron-sulfur assembly ATPase	Cyanothece sp. PCC 8801 Gene: PCC8801_0416: Iron-sulfur assembly ATPase	Cyanothece sp. PCC 7425 Gene: Cyan7425_3444: Iron-sulfur assembly ATPase	Microcystis aeruginosa NIES-843 Gene: MAE_23080: Iron-sulfur assembly ATPase	Nostoc sp. PCC 7120 Gene: alr2493: Iron-sulfur assembly ATPase	Trichodesmium erythraeum IMS101 Gene: Tery_4356: Iron-sulfur assembly ATPase	Synechococcus elongatus PCC 7942 Gene: Synpcc7942_1736: Iron-sulfur assembly ATPase	Prochlorococcus marinus str. MIT 9313 Gene: PMT1605: Iron-sulfur assembly ATPase	Synechococcus sp. JA-3-3Ab Gene: CYA_2193: Iron-sulfur assembly ATPase	Synechococcus sp. WH 8102 Gene: SYNW0320: Iron-sulfur assembly ATPase	Gloeobacter violaceus PCC 7421 Gene: glr1371: Iron-sulfur assembly ATPase	Thermosynechococcus elongatus BP-1 Gene: tlr1904: Iron-sulfur assembly ATPase	Iron-sulfur assembly ATPase
sufD	Synechococcus sp. PCC 7002 Gene: SYNPCC7002_A1812: Iron-sulfur assembly protein	Synechocystis sp. PCC 6803 Gene: slr0076: Iron-sulfur assembly protein	* Cyanothece sp. ATCC 51142 Site: position = -137 score = 5.81499 sequence = TTTAACAACATTTTTGTTGCTAAA Gene: cce_1005: Iron-sulfur assembly protein	Cyanothece sp. PCC 8801 Gene: PCC8801_0417: Iron-sulfur assembly protein	Cyanothece sp. PCC 7425 Gene: Cyan7425_3443: Iron-sulfur assembly protein	Microcystis aeruginosa NIES-843 Gene: MAE_23070: Iron-sulfur assembly protein	Nostoc sp. PCC 7120 Gene: alr2494: Iron-sulfur assembly protein	Trichodesmium erythraeum IMS101 Gene: Tery_4357: Iron-sulfur assembly protein	Synechococcus elongatus PCC 7942 Gene: Synpcc7942_1737: Iron-sulfur assembly protein	Prochlorococcus marinus str. MIT 9313 Gene: PMT1604: Iron-sulfur assembly protein	Synechococcus sp. JA-3-3Ab Gene: CYA_2194: Iron-sulfur assembly protein	Synechococcus sp. WH 8102 Gene: SYNW0321: Iron-sulfur assembly protein	Gloeobacter violaceus PCC 7421 Gene: glr1372: Iron-sulfur assembly protein	Thermosynechococcus elongatus BP-1 Gene: tlr1905: Iron-sulfur assembly protein	Iron-sulfur assembly protein
sufS	Synechococcus sp. PCC 7002 Gene: SYNPCC7002_A1811: Cysteine desulfurase (EC 2.8.1.7)	Synechocystis sp. PCC 6803 Gene: slr0077: Cysteine desulfurase (EC 2.8.1.7)	Cyanothece sp. ATCC 51142 Gene: cce_1004: Cysteine desulfurase (EC 2.8.1.7)	Cyanothece sp. PCC 8801 Gene: PCC8801_0418: Cysteine desulfurase (EC 2.8.1.7)	Cyanothece sp. PCC 7425 Gene: Cyan7425_3442: Cysteine desulfurase (EC 2.8.1.7)	Microcystis aeruginosa NIES-843 Gene: MAE_23060: Cysteine desulfurase (EC 2.8.1.7)	Nostoc sp. PCC 7120 Gene: alr2495: Cysteine desulfurase (EC 2.8.1.7)	Trichodesmium erythraeum IMS101 Gene: Tery_4358: Cysteine desulfurase (EC 2.8.1.7)	Synechococcus elongatus PCC 7942 Gene: Synpcc7942_1738: Cysteine desulfurase (EC 2.8.1.7)	Prochlorococcus marinus str. MIT 9313 Gene: PMT1603: Cysteine desulfurase (EC 2.8.1.7)	Synechococcus sp. JA-3-3Ab Gene: CYA_0391: Cysteine desulfurase (EC 2.8.1.7)	Synechococcus sp. WH 8102 Gene: SYNW0322: Cysteine desulfurase (EC 2.8.1.7)	Gloeobacter violaceus PCC 7421 Gene: glr1373: Cysteine desulfurase (EC 2.8.1.7)	Thermosynechococcus elongatus BP-1 Gene: null: Cysteine desulfurase (EC 2.8.1.7)	Cysteine desulfurase (EC 2.8.1.7)
ftrC	Synechococcus sp. PCC 7002	Synechocystis sp. PCC 6803	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 8801	Cyanothece sp. PCC 7425	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120	Trichodesmium erythraeum IMS101	* Synechococcus elongatus PCC 7942 Site: position = -101 score = 5.13968 sequence = TTTGACAACATTGATGTTGTTCAA Site: position = -63 score = 5.06048 sequence = TTAAGCAACGTCTGTGTTGTTCAA Gene: Synpcc7942_1734: Ferredoxin thioredoxin reductase catalytic chain	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	* Synechococcus sp. WH 8102 Site: position = -39 score = 4.85631 sequence = TAAGGAAACCAGGTCGTTTCGTAA Gene: SYNW0318: Ferredoxin thioredoxin reductase catalytic chain	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	Ferredoxin thioredoxin reductase catalytic chain

CRON 2.
sufR	* Synechococcus sp. PCC 7002 Site: position = -39 score = 5.78826 sequence = TTTAACAACAAAAAAGTTGTCAAA Site: position = -80 score = 5.54478 sequence = TTTAACAACTGTTTGGTTGTTTTA Gene: SYNPCC7002_A1815: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria	* Synechocystis sp. PCC 6803 Site: position = -163 score = 5.56626 sequence = TAAAACAACAGGTAAGTTGTTTTA Site: position = -123 score = 5.61869 sequence = ATTAGCAACCCGATTGTTGTCAAA Gene: sll0088: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria	* Cyanothece sp. ATCC 51142 Site: position = -109 score = 5.69064 sequence = ATTAACAACTCAATTGTTGTCAAA Site: position = -149 score = 5.74771 sequence = TAAAACAACATTTATGTTTCTTTA Gene: cce_0683: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria	* Cyanothece sp. PCC 8801 Site: position = -160 score = 5.57277 sequence = AATAACAACCCCATTGTTGTCAAA Site: position = -200 score = 5.67787 sequence = TTAAACAACATTTTTGTTGCTCAA Gene: PCC8801_0414: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria	* Cyanothece sp. PCC 7425 Site: position = -74 score = 5.83418 sequence = TTTAGCAACACATCAGTTGTCTAA Site: position = -113 score = 5.54276 sequence = TTAAACAACTCAGGCGTTGCTTAA Gene: Cyan7425_3451: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria	* Microcystis aeruginosa NIES-843 Site: position = -182 score = 5.89491 sequence = TTAAACAACAATAAAGTTGTTTAA Site: position = -142 score = 5.68911 sequence = ATTAACAACAAAGCTGTTGTCAAA Gene: MAE_23100: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria	* Nostoc sp. PCC 7120 Site: position = -101 score = 5.94534 sequence = TAAAACAACATCGATGTTGTTTAA Site: position = -56 score = 5.74124 sequence = ATTAACAACAACAATGTTGTCAAA Gene: all2491: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria	* Trichodesmium erythraeum IMS101 Site: position = -212 score = 6.03008 sequence = TTAAACAACTTATTTGTTGTTTAA Gene: Tery_4354: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria	* Synechococcus elongatus PCC 7942 Site: position = -98 score = 5.65463 sequence = TTGAACAACATCAATGTTGTCAAA Site: position = -136 score = 5.72133 sequence = TTGAACAACACAGACGTTGCTTAA Gene: Synpcc7942_1733: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria	* Prochlorococcus marinus str. MIT 9313 Site: position = -204 score = 5.03297 sequence = AAACGAAACCTATTGGTTTCGTTT Gene: PMT1607: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria	* Synechococcus sp. JA-3-3Ab Site: position = -119 score = 5.95767 sequence = TAAAACAACACGGTTGTTGCTTAA Gene: CYA_2189: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria	* Synechococcus sp. WH 8102 Site: position = -68 score = 4.87451 sequence = TTACGAAACGACCTGGTTTCCTTA Gene: SYNW0317: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria	Gloeobacter violaceus PCC 7421	* Thermosynechococcus elongatus BP-1 Site: position = -40 score = 5.89961 sequence = TTTAGCAACAAAACGGTTGTTTTA Site: position = -78 score = 5.65142 sequence = TTAAGCAACGAGATGGTTGCTTTA Gene: tlr0491: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria	Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria

CRON 3.
nifJ	* Synechococcus sp. PCC 7002 Site: position = -152 score = 5.11538 sequence = TTTAGCAAGCATTTTGTTGTTAAA Gene: SYNPCC7002_A1443: Pyruvate oxidoreductase	* Synechocystis sp. PCC 6803 Site: position = -172 score = 4.92307 sequence = AAAAACAATCTTGACGTTGTTTAA Gene: sll0741: Pyruvate oxidoreductase	* Cyanothece sp. ATCC 51142 Site: position = -133 score = 5.56327 sequence = AAAAACAACCCTAATGTTGTGTTA Gene: cce_0953: Pyruvate oxidoreductase	* Cyanothece sp. PCC 8801 Site: position = -134 score = 5.46903 sequence = AAAAACAACCATGAAGTTGTCTTA Gene: PCC8801_3918: Pyruvate oxidoreductase	Cyanothece sp. PCC 7425 Gene: Cyan7425_4369: Pyruvate oxidoreductase	Microcystis aeruginosa NIES-843 Gene: MAE_38140: Pyruvate oxidoreductase	2 Nostoc sp. PCC 7120 Gene: alr2803: Pyruvate oxidoreductase Gene: alr1911: Pyruvate oxidoreductase	Trichodesmium erythraeum IMS101	Synechococcus elongatus PCC 7942 Gene: Synpcc7942_2384: Pyruvate oxidoreductase	Prochlorococcus marinus str. MIT 9313	Synechococcus sp. JA-3-3Ab	Synechococcus sp. WH 8102	Gloeobacter violaceus PCC 7421	Thermosynechococcus elongatus BP-1	Pyruvate oxidoreductase

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog SufR - Cyanobacteria

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --