Regulon of SufR in Prochlorococcus marinus str. MIT 9313

Properties
Regulator type:	Transcription factor
TF locus tag:	PMT1607
Regulator family:	[Other]
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	SufR - Cyanobacteria
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 48 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By TF family - [Other]
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -204 Score: 5 Sequence: AAACGAAACCTATTGGTTTCGTTT Locus tag: PMT1607 Name: sufR Funciton: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
	PMT1607	sufR	Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
Position: -194 Score: 5 Sequence: AAACGAAACCAATAGGTTTCGTTT Locus tag: PMT1606 Name: sufB Funciton: Iron-sulfur assembly protein Locus tag: PMT1605 Name: sufC Funciton: Iron-sulfur assembly ATPase Locus tag: PMT1604 Name: sufD Funciton: Iron-sulfur assembly protein Locus tag: PMT1603 Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7)
	PMT1606	sufB	Iron-sulfur assembly protein
	PMT1605	sufC	Iron-sulfur assembly ATPase
	PMT1604	sufD	Iron-sulfur assembly protein
	PMT1603	sufS	Cysteine desulfurase (EC 2.8.1.7)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD