Regulon of SufR in Cyanothece sp. PCC 7425

Properties
Regulator type:	Transcription factor
TF locus tag:	Cyan7425_3451
Regulator family:	[Other]
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	SufR - Cyanobacteria
Statistics of regulated genes:
- Genes	10
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 48 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By TF family - [Other]
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -113 Score: 5.5 Sequence: TTAAACAACTCAGGCGTTGCTTAA Position: -74 Score: 5.8 Sequence: TTTAGCAACACATCAGTTGTCTAA Locus tag: Cyan7425_3451 Name: sufR Funciton: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
	Cyan7425_3451	sufR	Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
Position: -106 Score: 5 Sequence: TTAGACAACTGATGTGTTGCTAAA Position: -67 Score: 5.3 Sequence: TTAAGCAACGCCTGAGTTGTTTAA Locus tag: Cyan7425_3450 Name: sufB Funciton: Iron-sulfur assembly protein Locus tag: Cyan7425_3449 Name: null Funciton: Hypothetical protein Locus tag: Cyan7425_3448 Name: null Funciton: Hypothetical protein Locus tag: Cyan7425_3447 Name: null Funciton: Hypothetical protein Locus tag: Cyan7425_3446 Name: Cyan7425_3446 Funciton: Predicted oxoglutarate/iron-dependent oxygenase Locus tag: Cyan7425_3445 Name: Cyan7425_3445 Funciton: Conserved hypothetical protein Locus tag: Cyan7425_3444 Name: sufC Funciton: Iron-sulfur assembly ATPase Locus tag: Cyan7425_3443 Name: sufD Funciton: Iron-sulfur assembly protein Locus tag: Cyan7425_3442 Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7)
	Cyan7425_3450	sufB	Iron-sulfur assembly protein
	Cyan7425_3449		Hypothetical protein
	Cyan7425_3448		Hypothetical protein
	Cyan7425_3447		Hypothetical protein
	Cyan7425_3446	Cyan7425_3446	Predicted oxoglutarate/iron-dependent oxygenase
	Cyan7425_3445	Cyan7425_3445	Conserved hypothetical protein
	Cyan7425_3444	sufC	Iron-sulfur assembly ATPase
	Cyan7425_3443	sufD	Iron-sulfur assembly protein
	Cyan7425_3442	sufS	Cysteine desulfurase (EC 2.8.1.7)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD