Regulog CzrA - Bacillales

Properties
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance
Effector:	Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+)
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - CzrA
By TF family - ArsR
By effector - Zinc ion, (Zn2+)
By effector - Silver ion, (Ag+)
By effector - Nickel ion, (Ni2+)
By effector - Copper ion, (Cu2+)
By effector - Cobalt ion, (Co2+)
By effector - Cadmium, ion (Cd2+)
By pathway - Zinc resistance
By pathway - Nickel resistance
By pathway - Copper resistance
By pathway - Cobalt resistance
By pathway - Cadmium resistance

Statistics of regulated genes
Genome	Genes	Operons
Bacillus subtilis subsp. subtilis str. 168	3	2
Bacillus amyloliquefaciens FZB42	3	2
Bacillus pumilus SAFR-032	1	1
Bacillus licheniformis DSM 13	2	2
Anoxybacillus flavithermus WK1	2	1
Geobacillus kaustophilus HTA426	5	2
Bacillus cereus ATCC 14579	3	2
Bacillus halodurans C-125
Bacillus clausii KSM-K16	2	1
Oceanobacillus iheyensis HTE831	2	1
Paenibacillus sp. JDR-2	2	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
czrA	Bacillus subtilis subsp. subtilis str. 168 Gene: BSU19120: Transcriptional repressor of multiple metal-sensing, ArsR family	Bacillus amyloliquefaciens FZB42 Gene: RBAM_018890: Transcriptional repressor of multiple metal-sensing, ArsR family	Bacillus pumilus SAFR-032 Gene: BPUM_1843: Transcriptional repressor of multiple metal-sensing, ArsR family	Bacillus licheniformis DSM 13 Gene: BLi02201: Transcriptional repressor of multiple metal-sensing, ArsR family	* Anoxybacillus flavithermus WK1 Site: position = -41 score = 7.23713 sequence = TATATGAACATATATTCATATA Gene: Aflv_1335: Transcriptional repressor of multiple metal-sensing, ArsR family	2 Geobacillus kaustophilus HTA426* Site: position = -43 score = 7.07801 sequence = TATATGAACAAATGCTCATATA Gene: GK1406: Transcriptional repressor of multiple metal-sensing, ArsR family Site: position = -48 score = 7.00209 sequence = CATATGAACATATGCTCATATA Gene: GK0580: Transcriptional repressor of multiple metal-sensing, ArsR family	* Bacillus cereus ATCC 14579 Site: position = -46 score = 5.74008 sequence = TATATGAatgatTGtTCATATg Gene: BC0595: Transcriptional repressor of multiple metal-sensing, ArsR family	Bacillus halodurans C-125	* Bacillus clausii KSM-K16 Site: position = -36 score = 6.83508 sequence = AATATGAACATATAATCATATA Gene: ABC3390: Transcriptional repressor of multiple metal-sensing, ArsR family	* Oceanobacillus iheyensis HTE831 Site: position = -39 score = 6.71542 sequence = AATATGAGCATATGATCATATT Gene: OB1400: Transcriptional repressor of multiple metal-sensing, ArsR family	Paenibacillus sp. JDR-2 Gene: Pjdr2_1132: Transcriptional repressor of multiple metal-sensing, ArsR family	Transcriptional repressor of multiple metal-sensing, ArsR family
czcD	* Bacillus subtilis subsp. subtilis str. 168 Site: position = -116 score = 7.1249 sequence = TATATGAACACATGCTCATATA Gene: BSU26650: Cation diffusion facilitator family transporter	2 Bacillus amyloliquefaciens FZB42* Site: position = -87 score = 7.27754 sequence = TATATGAGTATATGTTCATATA Gene: RBAM_030670: Cation diffusion facilitator family transporter Site: position = -106 score = 6.88294 sequence = TATATGAGCACATAATCATATA Gene: RBAM_005600: Cation diffusion facilitator family transporter	Bacillus pumilus SAFR-032	* Bacillus licheniformis DSM 13 Site: position = -45 score = 6.58461 sequence = AATATGAATACATGATCATATA Gene: BLi03452: Cation diffusion facilitator family transporter	Anoxybacillus flavithermus WK1	2 Geobacillus kaustophilus HTA426 Gene: GK1407: Cation diffusion facilitator family transporter Gene: GK0581: Cation diffusion facilitator family transporter	2 Bacillus cereus ATCC 14579 Gene: BC0596: Cation diffusion facilitator family transporter Gene: BC1701: Cation diffusion facilitator family transporter	Bacillus halodurans C-125	Bacillus clausii KSM-K16 Gene: ABC3389: Cation diffusion facilitator family transporter	Oceanobacillus iheyensis HTE831 Gene: OB1399: Cation diffusion facilitator family transporter	* Paenibacillus sp. JDR-2 Site: position = -44 score = 6.07141 sequence = CATATGAATAGTTGTTCATATA Gene: Pjdr2_0376: Cation diffusion facilitator family transporter	Cation diffusion facilitator family transporter
czcO	Bacillus subtilis subsp. subtilis str. 168 Gene: BSU26640: CzcD accessory protein (oxidoreductase)	Bacillus amyloliquefaciens FZB42 Gene: RBAM_005610: CzcD accessory protein (oxidoreductase)	Bacillus pumilus SAFR-032	Bacillus licheniformis DSM 13	Anoxybacillus flavithermus WK1	Geobacillus kaustophilus HTA426 Gene: GK0582: CzcD accessory protein (oxidoreductase)	* Bacillus cereus ATCC 14579 Site: position = -44 score = 6.03743 sequence = TATATGAACAAATATTCATACG Gene: BC3447: CzcD accessory protein (oxidoreductase)	Bacillus halodurans C-125 Gene: BH3677: CzcD accessory protein (oxidoreductase)	Bacillus clausii KSM-K16 Gene: ABC0270: CzcD accessory protein (oxidoreductase)	Oceanobacillus iheyensis HTE831	Paenibacillus sp. JDR-2	CzcD accessory protein (oxidoreductase)
cadA	* Bacillus subtilis subsp. subtilis str. 168 Site: position = -94 score = 7.31796 sequence = TATATGAGTATATGCTCATATA Gene: BSU33490: Cadmium-transporting ATPase (EC 3.6.3.3)	Bacillus amyloliquefaciens FZB42	* Bacillus pumilus SAFR-032 Site: position = -87 score = 7.27754 sequence = TATATGAATATATGCTCATATA Gene: BPUM_3010: Cadmium-transporting ATPase (EC 3.6.3.3)	* Bacillus licheniformis DSM 13 Site: position = -61 score = 6.92436 sequence = TATATGCGTATATGCTCATATA Gene: BLi03539: Cadmium-transporting ATPase (EC 3.6.3.3)	Anoxybacillus flavithermus WK1 Gene: Aflv_1336: Cadmium-transporting ATPase (EC 3.6.3.3)	Geobacillus kaustophilus HTA426	Bacillus cereus ATCC 14579	Bacillus halodurans C-125	Bacillus clausii KSM-K16 Gene: ABC0269: Cadmium-transporting ATPase (EC 3.6.3.3)	Oceanobacillus iheyensis HTE831	* Paenibacillus sp. JDR-2 Site: position = -41 score = 6.72972 sequence = TATATGAGCAAGTATTCATATA Gene: Pjdr2_1130: Cadmium-transporting ATPase (EC 3.6.3.3)	Cadmium-transporting ATPase (EC 3.6.3.3)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog CzrA - Bacillales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --