Regulog CzrA - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance |
| Effector: | Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+) |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By trascription factor - CzrA
- By TF family - ArsR
- By effector - Zinc ion, (Zn2+)
- By effector - Silver ion, (Ag+)
- By effector - Nickel ion, (Ni2+)
- By effector - Copper ion, (Cu2+)
- By effector - Cobalt ion, (Co2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Zinc resistance
- By pathway - Nickel resistance
- By pathway - Copper resistance
- By pathway - Cobalt resistance
- By pathway - Cadmium resistance
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 3 | 2 |
| Bacillus amyloliquefaciens FZB42 | 3 | 2 |
| Bacillus pumilus SAFR-032 | 1 | 1 |
| Bacillus licheniformis DSM 13 | 2 | 2 |
| Anoxybacillus flavithermus WK1 | 2 | 1 |
| Geobacillus kaustophilus HTA426 | 5 | 2 |
| Bacillus cereus ATCC 14579 | 3 | 2 |
| Bacillus halodurans C-125 | ||
| Bacillus clausii KSM-K16 | 2 | 1 |
| Oceanobacillus iheyensis HTE831 | 2 | 1 |
| Paenibacillus sp. JDR-2 | 2 | 2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| czrA |
Gene: BSU19120: Transcriptional repressor of multiple metal-sensing, ArsR family |
Gene: RBAM_018890: Transcriptional repressor of multiple metal-sensing, ArsR family |
Gene: BPUM_1843: Transcriptional repressor of multiple metal-sensing, ArsR family |
Gene: BLi02201: Transcriptional repressor of multiple metal-sensing, ArsR family |
*
Anoxybacillus flavithermus WK1 Site: position = -41 score = 7.23713 sequence = TATATGAACATATATTCATATA Gene: Aflv_1335: Transcriptional repressor of multiple metal-sensing, ArsR family |
*2
Geobacillus kaustophilus HTA426 Site: position = -43 score = 7.07801 sequence = TATATGAACAAATGCTCATATA Gene: GK1406: Transcriptional repressor of multiple metal-sensing, ArsR family Site: position = -48 score = 7.00209 sequence = CATATGAACATATGCTCATATA Gene: GK0580: Transcriptional repressor of multiple metal-sensing, ArsR family |
*
Bacillus cereus ATCC 14579 Site: position = -46 score = 5.74008 sequence = TATATGAatgatTGtTCATATg Gene: BC0595: Transcriptional repressor of multiple metal-sensing, ArsR family |
|
*
Bacillus clausii KSM-K16 Site: position = -36 score = 6.83508 sequence = AATATGAACATATAATCATATA Gene: ABC3390: Transcriptional repressor of multiple metal-sensing, ArsR family |
*
Oceanobacillus iheyensis HTE831 Site: position = -39 score = 6.71542 sequence = AATATGAGCATATGATCATATT Gene: OB1400: Transcriptional repressor of multiple metal-sensing, ArsR family |
Gene: Pjdr2_1132: Transcriptional repressor of multiple metal-sensing, ArsR family |
Transcriptional repressor of multiple metal-sensing, ArsR family |
| czcD |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -116 score = 7.1249 sequence = TATATGAACACATGCTCATATA Gene: BSU26650: Cation diffusion facilitator family transporter |
*2
Bacillus amyloliquefaciens FZB42 Site: position = -87 score = 7.27754 sequence = TATATGAGTATATGTTCATATA Gene: RBAM_030670: Cation diffusion facilitator family transporter Site: position = -106 score = 6.88294 sequence = TATATGAGCACATAATCATATA Gene: RBAM_005600: Cation diffusion facilitator family transporter |
|
*
Bacillus licheniformis DSM 13 Site: position = -45 score = 6.58461 sequence = AATATGAATACATGATCATATA Gene: BLi03452: Cation diffusion facilitator family transporter |
|
2
Geobacillus kaustophilus HTA426 Gene: GK1407: Cation diffusion facilitator family transporter Gene: GK0581: Cation diffusion facilitator family transporter |
2
Bacillus cereus ATCC 14579 Gene: BC0596: Cation diffusion facilitator family transporter Gene: BC1701: Cation diffusion facilitator family transporter |
|
Gene: ABC3389: Cation diffusion facilitator family transporter |
Gene: OB1399: Cation diffusion facilitator family transporter |
*
Paenibacillus sp. JDR-2 Site: position = -44 score = 6.07141 sequence = CATATGAATAGTTGTTCATATA Gene: Pjdr2_0376: Cation diffusion facilitator family transporter |
Cation diffusion facilitator family transporter |
| czcO |
Gene: BSU26640: CzcD accessory protein (oxidoreductase) |
Gene: RBAM_005610: CzcD accessory protein (oxidoreductase) |
|
|
|
Gene: GK0582: CzcD accessory protein (oxidoreductase) |
*
Bacillus cereus ATCC 14579 Site: position = -44 score = 6.03743 sequence = TATATGAACAAATATTCATACG Gene: BC3447: CzcD accessory protein (oxidoreductase) |
Gene: BH3677: CzcD accessory protein (oxidoreductase) |
Gene: ABC0270: CzcD accessory protein (oxidoreductase) |
|
|
CzcD accessory protein (oxidoreductase) |
| cadA |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -94 score = 7.31796 sequence = TATATGAGTATATGCTCATATA Gene: BSU33490: Cadmium-transporting ATPase (EC 3.6.3.3) |
|
*
Bacillus pumilus SAFR-032 Site: position = -87 score = 7.27754 sequence = TATATGAATATATGCTCATATA Gene: BPUM_3010: Cadmium-transporting ATPase (EC 3.6.3.3) |
*
Bacillus licheniformis DSM 13 Site: position = -61 score = 6.92436 sequence = TATATGCGTATATGCTCATATA Gene: BLi03539: Cadmium-transporting ATPase (EC 3.6.3.3) |
Gene: Aflv_1336: Cadmium-transporting ATPase (EC 3.6.3.3) |
|
|
|
Gene: ABC0269: Cadmium-transporting ATPase (EC 3.6.3.3) |
|
*
Paenibacillus sp. JDR-2 Site: position = -41 score = 6.72972 sequence = TATATGAGCAAGTATTCATATA Gene: Pjdr2_1130: Cadmium-transporting ATPase (EC 3.6.3.3) |
Cadmium-transporting ATPase (EC 3.6.3.3) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |