Propagation of SO4705 regulog to Shewanella loihica PV-4

Reference regulog properties
Source regulog:	SO4705 - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	XRE
Regulation mode:	repressor
Biological process:
Effector:
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Shewanella loihica PV-4
Orthologous TF(s)	Shew_2560
Regulated genes	2

Built upon 32 sites [see more]

Predicted regulatory interactions in *Shewanella loihica PV-4*
	Locus tag	Position	Score	Sequence
Position: -144 Score: 6.6 Sequence: TTGTAATGAAAAAGCCGCTAGACTACAA Locus tag: Shew_2559
	Shew_2559	-144	6.6	TTGTAATGAAAAAGCCGCTAGACTACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO4706
Ortholog function: Malate synthase-related protein
Shewanella loihica PV-4	Shew_2559	-144	6.6	TTGTAATGAAAAAGCCGCTAGACTACAA

Position: -65 Score: 6.6 Sequence: TTGTAGTCTAGCGGCTTTTTCATTACAA Locus tag: Shew_2560
	Shew_2560	-65	6.6	TTGTAGTCTAGCGGCTTTTTCATTACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO4705
Ortholog function: transcriptional regulator, XRE family
Shewanella oneidensis MR-1	SO_4705	-86	7.4	TTGTAGTCTAGTGTATTTTTTACTACAA
Shewanella putrefaciens CN-32	Sputcn32_3866	-65	7.3	TTGTAGTCTAGTCTTTTTTTGACTACAA
Shewanella sp W3-18-1	Sputw3181_0087	-65	7.3	TTGTAGTCTAGTCTTTTTTTGACTACAA
Shewanella sp ANA-3	Shewana3_4059	-65	7.3	TTGTAGTCTAGTCTTTTTTTGACTACAA
Shewanella sp MR-4	Shewmr4_3851	-65	7	TTGTAGTCTAGTCTTTTTTTGGCTACAA
Shewanella sp MR-7	Shewmr7_3944	-65	7.3	TTGTAGTCTAGTCTTTTTTTGACTACAA
Shewanella baltica OS155	Sbal_0106	-65	7.3	TTGTAGTCTAGTCTTTTTTTGACTACAA
Shewanella denitrificans OS217	Sden_0218	-65	7	TTGTAGTCTAAAACAATTTTCGCTACAA
Shewanella frigidimarina NCIMB 400	Sfri_3903	-64	4.8	TTtTAGTCTAtgcTATTTTTacaaACAA
Shewanella amazonensis SB2B	Sama_0680	-65	6.6	TTTTAGTCTATGTTATTTTTTACTACAA
Shewanella loihica PV-4	Shew_2560	-65	6.6	TTGTAGTCTAGCGGCTTTTTCATTACAA
Shewanella pealeana ATCC 700345	Spea_2004	-65	7	TTGTAGTCTAGTGTAATTTTCATTACAA
Shewanella halifaxensis HAW-EB4	Shal_2297	-65	6.9	TTGTAGTCTAGTGTAAATTTTATTACAA
Shewanella piezotolerans WP3	swp_2678	-65	5.7	TTGTAGTCTAGTGTAAAAACCGCTACAA
Shewanella sediminis HAW-EB3	Ssed_1608	-65	7.1	TTGTAGTCTAGCGAATTTTTTACTACAA
Shewanella woodyi ATCC 51908	Swoo_3044	-84	6.8	TTGTAGTCTAGCTAATTTTTCATTACAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Propagation of SO4705 regulog to Shewanella loihica PV-4

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --