Propagation of SO0072 regulog to Shewanella loihica PV-4

Reference regulog properties
Source regulog:	SO0072 - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Shewanella loihica PV-4
Orthologous TF(s)	Shew_3779
Regulated genes	2

Built upon 29 sites [see more]

Predicted regulatory interactions in *Shewanella loihica PV-4*
	Locus tag	Position	Score	Sequence
Position: -34 Score: 7.1 Sequence: TGTATCAATGTATTAATACA Locus tag: Shew_3779
	Shew_3779	-34	7.1	TGTATCAATGTATTAATACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO0072
Ortholog function: Transcriptional regulator, GntR family, YtrA subfamily
Shewanella sp ANA-3	Shewana3_0077	-34	7.1	TGTATCAATGTATTAATACA
Shewanella sp MR-4	Shewmr4_0075	-34	7.1	TGTATCAATGTATTAATACA
Shewanella sp MR-7	Shewmr7_0073	-34	7.1	TGTATCAATGTATTAATACA
Shewanella frigidimarina NCIMB 400	Sfri_3976	-34	7.1	TGTATCAATGTATTAATACA
Shewanella loihica PV-4	Shew_3779	-34	7.1	TGTATCAATGTATTAATACA

Position: -101 Score: 7.1 Sequence: TGTATTAATACATTGATACA Locus tag: Shew_3780
	Shew_3780	-101	7.1	TGTATTAATACATTGATACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: PF00561
Ortholog function: Hydrolase, alpha/beta hydrolase fold family
Shewanella oneidensis MR-1	SO0071	-78	7.1	TGTATTAATACATTGATACA
Shewanella putrefaciens CN-32	Sputcn32_0057	-79	7.1	TGTATTAATACATTGATACA
Shewanella sp W3-18-1	Sputw3181_4021	-79	7.1	TGTATTAATACATTGATACA
Shewanella sp ANA-3	Shewana3_0076	-78	7.1	TGTATTAATACATTGATACA
Shewanella sp MR-4	Shewmr4_0074	-78	7.1	TGTATTAATACATTGATACA
Shewanella sp MR-7	Shewmr7_0072	-78	7.1	TGTATTAATACATTGATACA
Shewanella baltica OS155	Sbal_4278	-79	7.1	TGTATTAATACATTGATACA
Shewanella denitrificans OS217	Sden_0068	-73	6.9	TGTATTAATTCATTGATACA
Shewanella frigidimarina NCIMB 400	Sfri_3977	-80	7.1	TGTATTAATACATTGATACA
Shewanella amazonensis SB2B	Sama_3575	-83	6.1	TGAATCACTGTATTAATACA
		-75	7.1	TGTATTAATACATTGATACA
Shewanella loihica PV-4	Shew_3780	-101	7.1	TGTATTAATACATTGATACA
Shewanella pealeana ATCC 700345	Spea_4190	-76	7.1	TGTATTAATACATTGATACA
Shewanella piezotolerans WP3	swp_0108	-133	7.1	TGTATTAATACATTGATACA
Shewanella woodyi ATCC 51908	Swoo_4864	-75	7.1	TGTATTAATACATTGATACA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Propagation of SO0072 regulog to Shewanella loihica PV-4

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --