Propagation of LldR regulog to Shewanella baltica OS185
Source regulog: | LldR - Shewanellaceae |
Regulator type: | Transcription factor |
Regulator family: | LysR |
Regulation mode: | activator (repressor) |
Biological process: | Lactate utilization |
Effector: | L-lactate |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Shewanella baltica OS185 |
Orthologous TF(s) | Shew185_3149 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -123
Score: 5.7 Sequence: TAAATTAGGGCTACTTATTCC
Locus tag: Shew185_1338
|
||||
Shew185_1338 | -123 | 5.7 | TAAATTAGGGCTACTTATTCC | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: lldE | ||||
Ortholog function: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE | ||||
Shewanella oneidensis MR-1 | SO_1520 | -123 | 6.2 | TAAATTAGGGCTACTTATTTA |
Shewanella putrefaciens CN-32 | Sputcn32_1270 | -123 | 6.2 | TAAATTAGGACTACTTATTTC |
Shewanella sp W3-18-1 | Sputw3181_2836 | -123 | 6.2 | TAAATTAGGACTACTTATTTC |
Shewanella sp ANA-3 | Shewana3_2906 | -91 | 6.3 | TAAATTAGCGCTACTTATTTA |
Shewanella sp MR-4 | Shewmr4_2736 | -123 | 6.3 | TAAATTAGCGCTACTTATTTA |
Shewanella sp MR-7 | Shewmr7_2809 | -123 | 6.3 | TAAATTAGCGCTACTTATTTA |
Shewanella baltica OS155 | Sbal_1352 | -123 | 5.7 | TAAATTAGGGCTACTTATTCC |
Shewanella frigidimarina NCIMB 400 | Sfri_1852 | -133 | 5.2 | TTAATTAGCACTACATTTTAT |
Shewanella amazonensis SB2B | Sama_2441 | -115 | 4.1 | TActaAAtTACcACTAtTTTA |
Shewanella loihica PV-4 | Shew_3004 | -154 | 6.1 | TAAATTAGCACTACTTATTAT |
Shewanella pealeana ATCC 700345 | Spea_2996 | -168 | 5.8 | TAAATTAGCACTACTTTTTAC |
Shewanella halifaxensis HAW-EB4 | Shal_3085 | -168 | 5.8 | TAAATTAGCACTACTTTTTAC |
Shewanella piezotolerans WP3 | swp_3635 | -154 | 5.8 | TAAATTAGCACTACTTTTTAT |
Shewanella sediminis HAW-EB3 | Ssed_3924 | -149 | 6.1 | TAAATTAGCACTACTTATTAT |