Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of LldR regulog to Shewanella baltica OS185

Reference regulog properties
Source regulog: LldR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: LysR
Regulation mode: activator (repressor)
Biological process: Lactate utilization
Effector: L-lactate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Shewanella baltica OS185
Orthologous TF(s) Shew185_3149
Regulated genes 1
Built upon 14 sites [see more]
Predicted regulatory interactions in Shewanella baltica OS185
Locus tag Position Score Sequence
Position: -123
Score: 5.7
Sequence: TAAATTAGGGCTACTTATTCC
Locus tag: Shew185_1338
Shew185_1338 -123 5.7 TAAATTAGGGCTACTTATTCC
Supported by regulated orthologs from reference regulons
Ortholog gene name: lldE
Ortholog function: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
Shewanella oneidensis MR-1 SO_1520 -123 6.2 TAAATTAGGGCTACTTATTTA
Shewanella putrefaciens CN-32 Sputcn32_1270 -123 6.2 TAAATTAGGACTACTTATTTC
Shewanella sp W3-18-1 Sputw3181_2836 -123 6.2 TAAATTAGGACTACTTATTTC
Shewanella sp ANA-3 Shewana3_2906 -91 6.3 TAAATTAGCGCTACTTATTTA
Shewanella sp MR-4 Shewmr4_2736 -123 6.3 TAAATTAGCGCTACTTATTTA
Shewanella sp MR-7 Shewmr7_2809 -123 6.3 TAAATTAGCGCTACTTATTTA
Shewanella baltica OS155 Sbal_1352 -123 5.7 TAAATTAGGGCTACTTATTCC
Shewanella frigidimarina NCIMB 400 Sfri_1852 -133 5.2 TTAATTAGCACTACATTTTAT
Shewanella amazonensis SB2B Sama_2441 -115 4.1 TActaAAtTACcACTAtTTTA
Shewanella loihica PV-4 Shew_3004 -154 6.1 TAAATTAGCACTACTTATTAT
Shewanella pealeana ATCC 700345 Spea_2996 -168 5.8 TAAATTAGCACTACTTTTTAC
Shewanella halifaxensis HAW-EB4 Shal_3085 -168 5.8 TAAATTAGCACTACTTTTTAC
Shewanella piezotolerans WP3 swp_3635 -154 5.8 TAAATTAGCACTACTTTTTAT
Shewanella sediminis HAW-EB3 Ssed_3924 -149 6.1 TAAATTAGCACTACTTATTAT
© 2009-2020 RegPrecise