Propagation of SoxR regulog to Shewanella piezotolerans WP3

Reference regulog properties
Source regulog:	SoxR - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Superoxide stress response
Effector:	Paraquat
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Shewanella piezotolerans WP3
Orthologous TF(s)	swp_2307
Regulated genes	2

Built upon 12 sites [see more]

Predicted regulatory interactions in *Shewanella piezotolerans WP3*
	Locus tag	Position	Score	Sequence
Position: -293 Score: 6.7 Sequence: ACATCAAGTTAACTTGAGGT Position: -49 Score: 6 Sequence: ATCTCAAGTTAACTTTAGAT Locus tag: swp_2307
	swp_2307	-293	6.7	ACATCAAGTTAACTTGAGGT
		-49	6	ATCTCAAGTTAACTTTAGAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: soxR
Ortholog function: Redox-sensitive transcriptional activator, MerR family
Shewanella denitrificans OS217	Sden_2125	-116	7.3	ACCTCAAGTTAGCTTGAGGT
Shewanella frigidimarina NCIMB 400	Sfri_1565	-64	7	ACCTAAAGCTAACTTGAGGT
Shewanella piezotolerans WP3	swp_2307	-49	6	ATCTCAAGTTAACTTTAGAT

Position: -69 Score: 6.7 Sequence: ACCTCAAGTTAACTTGATGT Locus tag: swp_2308
	swp_2308	-69	6.7	ACCTCAAGTTAACTTGATGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: acrA
Ortholog function: Probable RND efflux membrane fusion protein
Shewanella piezotolerans WP3	swp_2308	-69	6.7	ACCTCAAGTTAACTTGATGT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --