Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of NsrR regulog to Shewanella piezotolerans WP3

Reference regulog properties
Source regulog: NsrR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Nitrosative stress response
Effector: Nitric oxide
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Shewanella piezotolerans WP3
Orthologous TF(s) swp_0072
Regulated genes 2
Built upon 51 sites [see more]
Predicted regulatory interactions in Shewanella piezotolerans WP3
Locus tag Position Score Sequence
Position: -46
Score: 5.1
Sequence: AGATGCAAATAATATACTTGT
Locus tag: swp_0412
swp_0412 -46 5.1 AGATGCAAATAATATACTTGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: dnrN
Ortholog function: Nitric oxide-dependent regulator DnrN or NorA
Shewanella oneidensis MR-1 SO_4302 -126 5.6 AGCTGCAAATAATATGCATGT
Shewanella putrefaciens CN-32 Sputcn32_3576 -49 5.5 AGCTGCAAATAATATGAATGT
Shewanella sp W3-18-1 Sputw3181_3715 -49 5.5 AGCTGCAAATAATATGAATGT
Shewanella sp ANA-3 Shewana3_0397 -49 5.6 AGCTGCAAATATTATGCATGT
Shewanella sp MR-4 Shewmr4_0398 -49 5.6 AGCTGCAAATATTATGCATGT
Shewanella sp MR-7 Shewmr7_3627 -49 5.6 AGCTGCAAATATTATGCATGT
Shewanella baltica OS155 Sbal_3989 -48 5.7 AGATGCAAATAATATGAATGT
Shewanella frigidimarina NCIMB 400 Sfri_0450 -26 5.2 AGATGCACATAAAATACATGT
Shewanella amazonensis SB2B Sama_3236 -34 4.6 ACATGCATACAGATTGCAGCT
Shewanella pealeana ATCC 700345 Spea_0383 -60 5.9 AGATGCAAATAATATGCATGT
Shewanella piezotolerans WP3 swp_0412 -46 5.1 AGATGCAAATAATATACTTGT
Shewanella sediminis HAW-EB3 Ssed_4124 -32 4.8 AGATATAAATAATTTGCAGCT
Shewanella woodyi ATCC 51908 Swoo_0492 -33 4.9 ACATGCAAATACAAAGCAGCT
Position: -40
Score: 4.2
Sequence: AGGTACATTAAAAATACCTGT
Locus tag: swp_3404
swp_3404 -40 4.2 AGGTACATTAAAAATACCTGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nnrS2
Ortholog function: NnrS protein involved in response to NO
Shewanella sp ANA-3 Shewana3_2362 -46 4.5 AAGTGCAATTATTATGAAGCT
Shewanella denitrificans OS217 Sden_2837 -110 4.4 ACAatCATtaTAaATaCcTGT
Shewanella frigidimarina NCIMB 400 Sfri_3037 -64 5.6 AGATTTATATATTATGCATGT
Shewanella pealeana ATCC 700345 Spea_1227 -35 4.8 AGCTGTATTTTAAATGCGTGT
Shewanella piezotolerans WP3 swp_3404 -39 4.2 AggTaCATtaAAaATaCcTGT