Propagation of Fur regulog to Alteromonas macleodii 'Deep ecotype'

Reference regulog properties
Source regulog:	Fur - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria
Propagated regulon:
Target genome	Alteromonas macleodii 'Deep ecotype'
Orthologous TF(s)	MADE_01084
Regulated genes	5

Built upon 505 sites [see more]

Predicted regulatory interactions in *Alteromonas macleodii 'Deep ecotype'*
	Locus tag	Position	Score	Sequence
Position: -102 Score: 5.5 Sequence: AAATAGCAATAATTATCATTT Locus tag: MADE_00133
	MADE_00133	-102	5.5	AAATAGCAATAATTATCATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: Sden_3064
Ortholog function: TonB-dependent receptor
Shewanella putrefaciens CN-32	Sputcn32_0603	-91	5.1	AAATAACAATAACTATCATTA
Shewanella putrefaciens CN-32	Sputcn32_0603	-91	5.1	AAATAACAATAACTATCATTA
Shewanella sp W3-18-1	Sputw3181_3569	-91	5.1	AAATAACAATAACTATCATTA
Shewanella sp W3-18-1	Sputw3181_3569	-91	5.1	AAATAACAATAACTATCATTA
Shewanella denitrificans OS217	Sden_3064	-122	6.2	AAATAATAATGATTATCATTT
Shewanella denitrificans OS217	Sden_3064	-122	6.2	AAATAATAATGATTATCATTT
Shewanella frigidimarina NCIMB 400	Sfri_3717	-90	5.7	AAATGATAATGATTTCTATTT
Shewanella frigidimarina NCIMB 400	Sfri_2549	-195	5	GATTGATAACGAATCTCAATA
		-168	5.5	GAGTGATAATTATTATCAATT
		-91	5.6	TAATGATAATCATTAGCAATA
Shewanella frigidimarina NCIMB 400	Sfri_3717	-90	5.7	AAATGATAATGATTTCTATTT
Shewanella frigidimarina NCIMB 400	Sfri_2549	-195	5	GATTGATAACGAATCTCAATA
		-168	5.5	GAGTGATAATTATTATCAATT
		-91	5.6	TAATGATAATCATTAGCAATA
Shewanella loihica PV-4	Shew_3097	-136	5.9	AAATGATAACCATTCCCATTT
Shewanella loihica PV-4	Shew_3097	-136	5.9	AAATGATAACCATTCCCATTT

Position: -65 Score: 6.1 Sequence: AATTGATAATAATTCTCATTA Locus tag: MADE_02392
	MADE_02392	-65	6.1	AATTGATAATAATTCTCATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO4740
Ortholog function: Conserved hypothetical inner membrane protein
Shewanella oneidensis MR-1	SO4740	-60	6	TAATGAGAATTGTTATCATCT
Shewanella putrefaciens CN-32	Sputcn32_3921	-59	6	TAATGAGAATTGTTATCATCT
Shewanella sp W3-18-1	Sputw3181_4047	-59	6	TAATGAGAATTGTTATCATCT
Shewanella sp ANA-3	Shewana3_4124	-60	6	TAATGAGAATTGTTATCATCT
Shewanella sp MR-4	Shewmr4_3919	-60	6	TAATGAGAATTGTTATCATCT
Shewanella sp MR-7	Shewmr7_4011	-60	6	TAATGAGAATTGTTATCATCT
Shewanella baltica OS155	Sbal_4341	-59	6	TAATGAGAATTGTTATCATCT
Shewanella denitrificans OS217	Sden_3706	-50	6	TATTGATAACGATTATCATTT
Shewanella frigidimarina NCIMB 400	Sfri_4031	-46	6	TAATGAGAACTGTTATCATTT
Shewanella amazonensis SB2B	Sama_3636	-50	5.9	AAGTGATAACTATTATCATTT
Shewanella loihica PV-4	Shew_3815	-46	6.5	AAATGATAATAATTATCATTT
Shewanella pealeana ATCC 700345	Spea_4226	-47	5.9	AAATGAGAAGCGTTATCATTT
Shewanella halifaxensis HAW-EB4	Shal_4274	-47	6.3	AAATGATAACCATTATCATTT
Shewanella piezotolerans WP3	swp_5137	-46	6.1	AAATGATAATCGTTATCATCT
Shewanella sediminis HAW-EB3	Ssed_4479	-47	6.1	AGATGAGAATAGTTATCATTT
Shewanella woodyi ATCC 51908	Swoo_4887	-50	6.3	AAATGAGAACCATTATCATTT

Position: -107 Score: 5.9 Sequence: TAATGAGAATGTTTATCATTT Locus tag: MADE_03559
	MADE_03559	-107	5.9	TAATGAGAATGTTTATCATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO3914
Ortholog function: TonB-dependent siderophore receptor
Shewanella frigidimarina NCIMB 400	Sfri_0611	-103	5.8	AAATGATAATGATTTGTATTT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Propagation of Fur regulog to Alteromonas macleodii 'Deep ecotype'

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --