Propagation of SoxR regulog to Alteromonas macleodii 'Deep ecotype'

Reference regulog properties
Source regulog:	SoxR - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Superoxide stress response
Effector:	Paraquat
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Alteromonas macleodii 'Deep ecotype'
Orthologous TF(s)	MADE_01184, MADE_02646
Regulated genes	1

Built upon 12 sites [see more]

Predicted regulatory interactions in *Alteromonas macleodii 'Deep ecotype'*
	Locus tag	Position	Score	Sequence
Position: -43 Score: 5.9 Sequence: ACTTCAAGTTAACTTTAAGT Locus tag: MADE_01184
	MADE_01184	-43	5.9	ACTTCAAGTTAACTTTAAGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: soxR
Ortholog function: Redox-sensitive transcriptional activator, MerR family
Shewanella amazonensis SB2B	Sama_3347	-32	6.2	ACTTCAAGTCAACTTGAGGT
Shewanella loihica PV-4	Shew_0423	-32	5.7	ACTTCAAGTCGACTTGAGGT
Shewanella woodyi ATCC 51908	Swoo_3439	-113	4.4	AgtTaAAGTcgACTTtAaGT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --