Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SoxR regulog to Alteromonas macleodii 'Deep ecotype'

Reference regulog properties
Source regulog: SoxR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: repressor
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Alteromonas macleodii 'Deep ecotype'
Orthologous TF(s) MADE_01184, MADE_02646
Regulated genes 1
Built upon 12 sites [see more]
Predicted regulatory interactions in Alteromonas macleodii 'Deep ecotype'
Locus tag Position Score Sequence
Position: -43
Score: 5.9
Sequence: ACTTCAAGTTAACTTTAAGT
Locus tag: MADE_01184
MADE_01184 -43 5.9 ACTTCAAGTTAACTTTAAGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: soxR
Ortholog function: Redox-sensitive transcriptional activator, MerR family
Shewanella amazonensis SB2B Sama_3347 -32 6.2 ACTTCAAGTCAACTTGAGGT
Shewanella loihica PV-4 Shew_0423 -32 5.7 ACTTCAAGTCGACTTGAGGT
Shewanella woodyi ATCC 51908 Swoo_3439 -113 4.4 AgtTaAAGTcgACTTtAaGT