Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of LexA regulog to Pseudoalteromonas atlantica T6c

Reference regulog properties
Source regulog: LexA - Shewanellaceae
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Pseudoalteromonas atlantica T6c
Orthologous TF(s) Patl_4247
Regulated genes 7
Built upon 192 sites [see more]
Predicted regulatory interactions in Pseudoalteromonas atlantica T6c
Locus tag Position Score Sequence
Position: -44
Score: 6
Sequence: TACTGTATGAATATACAGTA
Locus tag: Patl_0036
Patl_0036 -44 6 TACTGTATGAATATACAGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: imuA
Ortholog function: Predicted RecA/RadA recombinase
Shewanella amazonensis SB2B Sama_1865 -66 5.9 TACTGTATAAATATACAGTT
Shewanella loihica PV-4 Shew_2102 -145 6.1 TACTGTATTTATATACAGTG