Propagation of LexA regulog to Pseudoalteromonas atlantica T6c
| Source regulog: | LexA - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Pseudoalteromonas atlantica T6c |
| Orthologous TF(s) | Patl_4247 |
| Regulated genes | 7 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -44
Score: 6 Sequence: TACTGTATGAATATACAGTA
Locus tag: Patl_0036
|
||||
| Patl_0036 | -44 | 6 | TACTGTATGAATATACAGTA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: imuA | ||||
| Ortholog function: Predicted RecA/RadA recombinase | ||||
| Shewanella amazonensis SB2B | Sama_1865 | -66 | 5.9 | TACTGTATAAATATACAGTT |
| Shewanella loihica PV-4 | Shew_2102 | -145 | 6.1 | TACTGTATTTATATACAGTG |