Propagation of LexA regulog to Pseudoalteromonas atlantica T6c

Reference regulog properties
Source regulog:	LexA - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Pseudoalteromonas atlantica T6c
Orthologous TF(s)	Patl_4247
Regulated genes	7

Built upon 192 sites [see more]

Predicted regulatory interactions in *Pseudoalteromonas atlantica T6c*
	Locus tag	Position	Score	Sequence
Position: -44 Score: 6 Sequence: TACTGTATGAATATACAGTA Locus tag: Patl_0036
	Patl_0036	-44	6	TACTGTATGAATATACAGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: imuA
Ortholog function: Predicted RecA/RadA recombinase
Shewanella amazonensis SB2B	Sama_1865	-66	5.9	TACTGTATAAATATACAGTT
Shewanella loihica PV-4	Shew_2102	-145	6.1	TACTGTATTTATATACAGTG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --