Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SdpR regulog to Geobacillus sp. Y412MC61

Reference regulog properties
Source regulog: SdpR - Bacillales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Toxin-antitoxin system
Effector: SdpI, signal transduction protein
Phylum: Firmicutes
Propagated regulon:
Target genome Geobacillus sp. Y412MC61
Orthologous TF(s) GYMC61_2973
Regulated genes 1
Built upon 9 sites [see more]
Predicted regulatory interactions in Geobacillus sp. Y412MC61
Locus tag Position Score Sequence
Position: -150
Score: 6
Sequence: ATTTAGATGTTTTTCTAAAT
Locus tag: GYMC61_2973
GYMC61_2973 -150 6 ATTTAGATGTTTTTCTAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: sdpR
Ortholog function: Transcriptional regulator of SdpC resistance operon
Bacillus subtilis subsp. subtilis str. 168 BSU33790 -53 6.2 ATTTATACAAATATCTAAAT
Bacillus licheniformis DSM 13 BLi00787 -42 6.3 ATTTAGTTAAATAACTAAAT
Anoxybacillus flavithermus WK1 Aflv_1587 -71 6.1 AATTAGAAATTTGTCTAAAT
-32 6.4 ATTTAGAAATTTGTCTAAAT
Geobacillus kaustophilus HTA426 GK2134 -148 5.4 ATTTAGATGTTTTTCTAAAC
Bacillus cereus ATCC 14579 BC4834 -47 6.1 GTTTAGATAAATATCTAAAT
Bacillus halodurans C-125 BH0945 -42 5.9 ATTTAAGTAATTGCTTAAAT
Paenibacillus sp. JDR-2 Pjdr2_5471 -54 6.4 ATTTAGAATATTATCTAAAT