Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of YisR regulog to Geobacillus sp. Y412MC61

Reference regulog properties
Source regulog: YisR - Bacillales
Regulator type: Transcription factor
Regulator family: AraC
Regulation mode: activator
Biological process: Metabolite transport
Effector:
Phylum: Firmicutes
Propagated regulon:
Target genome Geobacillus sp. Y412MC61
Orthologous TF(s) GYMC61_1509
Regulated genes 1
Built upon 6 sites [see more]
Predicted regulatory interactions in Geobacillus sp. Y412MC61
Locus tag Position Score Sequence
Position: -112
Score: 5.3
Sequence: TTTTGTCGGAAATGTGCAAG
Locus tag: GYMC61_1506
GYMC61_1506 -112 5.3 TTTTGTCGGAAATGTGCAAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: yisQ
Ortholog function: Na+-driven multidrug efflux pump, MATE family
Bacillus subtilis subsp. subtilis str. 168 BSU10820 -106 7.1 TTAAGTCGGATTTTTACAAG
Bacillus amyloliquefaciens FZB42 RBAM_010970 -105 7 TTAAGTCGGATTTTTGCAAG
Bacillus pumilus SAFR-032 BPUM_1013 -100 6.7 TGAAGTCGGATTTCTCCAAT
Bacillus licheniformis DSM 13 BLi01177 -103 6.9 TCAAGTCGGATTTCTCCAAG
Anoxybacillus flavithermus WK1 Aflv_2194 -101 6.3 TTAAGTCGGAAATGTACAAA
Geobacillus kaustophilus HTA426 GK0701 -34 5.4 TCAAGTCGGAATTTGAAAAA