Propagation of YfmP regulog to Bacillus subtilis subsp. subtilis str. NCIB 3610
Source regulog: | YfmP - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | MerR |
Regulation mode: | repressor |
Biological process: | Metal efflux |
Effector: | |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Bacillus subtilis subsp. subtilis str. NCIB 3610 |
Orthologous TF(s) | BsubsN3_010100004094 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -68
Score: 7 Sequence: AACTTAACGTTTACGTTAAGGT
Locus tag: BsubsN3_010100004094
|
||||
BsubsN3_010100004094 | -68 | 7 | AACTTAACGTTTACGTTAAGGT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: yfmP | ||||
Ortholog function: Transcriptional regulator of metal efflux transporter expression, MerR family | ||||
Bacillus subtilis subsp. subtilis str. 168 | BSU07390 | -68 | 7 | AACTTAACGTTTACGTTAAGGT |
Bacillus amyloliquefaciens FZB42 | RBAM_007640 | -69 | 6.9 | AAGTTTACGTTTACGTTAAGGT |
Bacillus pumilus SAFR-032 | BPUM_0692 | -71 | 6.6 | ACATTTACGTTTACGTTAAGGT |
Bacillus licheniformis DSM 13 | BLi00773 | -65 | 6.8 | AACTTAACGTTTACGTAAAAGT |
Bacillus cereus ATCC 14579 | BC5373 | -50 | 6.5 | AAGTTAACGTTAACGTAAAATG |
Paenibacillus sp. JDR-2 | Pjdr2_6009 | -69 | 6.5 | AAGTTAACGTTGACGTTAACAT |