Propagation of MsmR regulog to Bacillus subtilis subsp. subtilis str. NCIB 3610
Source regulog: | MsmR - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Alpha-galactosides utilization |
Effector: | Alpha-galactosides |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Bacillus subtilis subsp. subtilis str. NCIB 3610 |
Orthologous TF(s) | BsubsN3_010100016387 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -88
Score: 5.5 Sequence: TATTGTAACCGCTTACTTTT
Locus tag: BsubsN3_010100016387
|
||||
BsubsN3_010100016387 | -88 | 5.5 | TATTGTAACCGCTTACTTTT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: msmR | ||||
Ortholog function: Transcriptional regulator of alpha-galactoside utilization, LacI family | ||||
Bacillus subtilis subsp. subtilis str. 168 | BSU30260 | -88 | 5.5 | TATTGTAACCGCTTACTTTT |
Bacillus amyloliquefaciens FZB42 | RBAM_027180 | -93 | 5.4 | TGTTGAAAACGCTTACTCTC |
Bacillus pumilus SAFR-032 | BPUM_1754 | -80 | 4.4 | ACTTGAAAGCGCTTTACCAA |
Bacillus licheniformis DSM 13 | BLi01139 | -77 | 4.6 | TATTGAAAACTTTTACCTTG |
Bacillus halodurans C-125 | BH2227 | -97 | 5.8 | TATTGAAAACGCTTACCCTA |