Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of MsmR regulog to Bacillus subtilis subsp. subtilis str. NCIB 3610

Reference regulog properties
Source regulog: MsmR - Bacillales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Alpha-galactosides utilization
Effector: Alpha-galactosides
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus subtilis subsp. subtilis str. NCIB 3610
Orthologous TF(s) BsubsN3_010100016387
Regulated genes 1
Built upon 6 sites [see more]
Predicted regulatory interactions in Bacillus subtilis subsp. subtilis str. NCIB 3610
Locus tag Position Score Sequence
Position: -88
Score: 5.5
Sequence: TATTGTAACCGCTTACTTTT
Locus tag: BsubsN3_010100016387
BsubsN3_010100016387 -88 5.5 TATTGTAACCGCTTACTTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: msmR
Ortholog function: Transcriptional regulator of alpha-galactoside utilization, LacI family
Bacillus subtilis subsp. subtilis str. 168 BSU30260 -88 5.5 TATTGTAACCGCTTACTTTT
Bacillus amyloliquefaciens FZB42 RBAM_027180 -93 5.4 TGTTGAAAACGCTTACTCTC
Bacillus pumilus SAFR-032 BPUM_1754 -80 4.4 ACTTGAAAGCGCTTTACCAA
Bacillus licheniformis DSM 13 BLi01139 -77 4.6 TATTGAAAACTTTTACCTTG
Bacillus halodurans C-125 BH2227 -97 5.8 TATTGAAAACGCTTACCCTA