Regulog MsmR - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Alpha-galactosides utilization |
| Effector: | Alpha-galactosides |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - LacI
- By effector - Alpha-galactosides
- By pathway - Alpha-galactosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 5 | 1 |
| Bacillus amyloliquefaciens FZB42 | 5 | 1 |
| Bacillus pumilus SAFR-032 | 5 | 1 |
| Bacillus licheniformis DSM 13 | 5 | 2 |
| Anoxybacillus flavithermus WK1 | ||
| Geobacillus kaustophilus HTA426 | ||
| Bacillus cereus ATCC 14579 | ||
| Bacillus halodurans C-125 | 5 | 1 |
| Bacillus clausii KSM-K16 | ||
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| msmR |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -88 score = 5.53766 sequence = TATTGTAACCGCTTACTTTT Gene: BSU30260: Transcriptional regulator of alpha-galactoside utilization, LacI family |
*
Bacillus amyloliquefaciens FZB42 Site: position = -93 score = 5.40966 sequence = TGTTGAAAACGCTTACTCTC Gene: RBAM_027180: Transcriptional regulator of alpha-galactoside utilization, LacI family |
*
Bacillus pumilus SAFR-032 Site: position = -80 score = 4.39462 sequence = ACTTGAAAGCGCTTTACCAA Gene: BPUM_1754: Transcriptional regulator of alpha-galactoside utilization, LacI family |
*
Bacillus licheniformis DSM 13 Site: position = -77 score = 4.63121 sequence = TATTGAAAACTTTTACCTTG Gene: BLi01139: Transcriptional regulator of alpha-galactoside utilization, LacI family |
|
|
|
*
Bacillus halodurans C-125 Site: position = -97 score = 5.84411 sequence = TATTGAAAACGCTTACCCTA Gene: BH2227: Transcriptional regulator of alpha-galactoside utilization, LacI family |
|
|
Gene: Pjdr2_5455: Transcriptional regulator of alpha-galactoside utilization, LacI family |
Transcriptional regulator of alpha-galactoside utilization, LacI family |
| msmE |
Gene: BSU30270: Multiple sugar ABC transporter, stachyose-binding protein |
Gene: RBAM_027190: Multiple sugar ABC transporter, stachyose-binding protein |
Gene: BPUM_1753: Multiple sugar ABC transporter, stachyose-binding protein |
*
Bacillus licheniformis DSM 13 Site: position = -53 score = 4.87953 sequence = AAATGAAAGCGCTTTTTATT Gene: BLi01140: Multiple sugar ABC transporter, stachyose-binding protein |
|
|
|
Gene: BH2226: Multiple sugar ABC transporter, stachyose-binding protein |
|
|
|
Multiple sugar ABC transporter, stachyose-binding protein |
| msmF |
Gene: BSU30280: Multiple sugar ABC transporter, membrane-spanning permease protein MsmF |
Gene: RBAM_027200: Multiple sugar ABC transporter, membrane-spanning permease protein MsmF |
Gene: BPUM_1752: Multiple sugar ABC transporter, membrane-spanning permease protein MsmF |
Gene: BLi01141: Multiple sugar ABC transporter, membrane-spanning permease protein MsmF |
|
|
|
Gene: BH2225: Multiple sugar ABC transporter, membrane-spanning permease protein MsmF |
|
|
|
Multiple sugar ABC transporter, membrane-spanning permease protein MsmF |
| msmG |
Gene: BSU30290: Multiple sugar ABC transporter, membrane-spanning permease protein MsmG |
Gene: RBAM_027210: Multiple sugar ABC transporter, membrane-spanning permease protein MsmG |
Gene: BPUM_1751: Multiple sugar ABC transporter, membrane-spanning permease protein MsmG |
Gene: BLi01142: Multiple sugar ABC transporter, membrane-spanning permease protein MsmG |
|
|
|
Gene: BH2224: Multiple sugar ABC transporter, membrane-spanning permease protein MsmG |
|
|
|
Multiple sugar ABC transporter, membrane-spanning permease protein MsmG |
| melA |
Gene: BSU30300: Alpha-galactosidase (EC 3.2.1.22) |
Gene: RBAM_027220: Alpha-galactosidase (EC 3.2.1.22) |
Gene: BPUM_1750: Alpha-galactosidase (EC 3.2.1.22) |
Gene: BLi01143: Alpha-galactosidase (EC 3.2.1.22) |
|
|
|
Gene: BH2228: Alpha-galactosidase (EC 3.2.1.22) |
Gene: ABC0732: Alpha-galactosidase (EC 3.2.1.22) |
|
Gene: Pjdr2_0045: Alpha-galactosidase (EC 3.2.1.22) |
Alpha-galactosidase (EC 3.2.1.22) |
| agaL |
|
|
|
|
|
|
|
Gene: BH2223: Alpha-galactosidase (EC 3.2.1.22) |
|
|
Gene: Pjdr2_5454: Alpha-galactosidase (EC 3.2.1.22) |
Alpha-galactosidase (EC 3.2.1.22) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |