Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of HisR regulog to Bacillus subtilis subsp. subtilis str. NCIB 3610

Reference regulog properties
Source regulog: HisR - Bacillales
Regulator type: Transcription factor
Regulator family: TrpR
Regulation mode: repressor
Biological process: Histidine biosynthesis
Effector: Histidine
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus subtilis subsp. subtilis str. NCIB 3610
Orthologous TF(s) BsubsN3_010100003674
Regulated genes 2
Built upon 20 sites [see more]
Predicted regulatory interactions in Bacillus subtilis subsp. subtilis str. NCIB 3610
Locus tag Position Score Sequence
Position: -39
Score: 5.7
Sequence: TACATTAGCAAACTAAAGGA
Locus tag: BsubsN3_010100017312
BsubsN3_010100017312 -39 5.7 TACATTAGCAAACTAAAGGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yuiF
Ortholog function: Histidine permease
Bacillus subtilis subsp. subtilis str. 168 BSU32040 -39 5.7 TACATTAGCAAACTAAAGGA
Bacillus amyloliquefaciens FZB42 RBAM_029090 -39 5.7 TACATTAGCAAACTAAAGGA
Bacillus pumilus SAFR-032 BPUM_2865 -36 5.8 TACATTAGTAAACTAAAGGA
Bacillus licheniformis DSM 13 BLi03386 -40 5.8 TACATTAGCAAACTAAAGTG
Anoxybacillus flavithermus WK1 Aflv_1385 -34 5.2 CAATTTATCAAACTAAAGTG
Bacillus halodurans C-125 BH3359 -47 5.1 TGATTTAATAAACTAAAGCA
Bacillus clausii KSM-K16 ABC2918 -30 4.8 TGATTTAATAAGATAAAGGA
Position: -65
Score: 5.3
Sequence: CATATTAGCGAACTAAAGGA
Locus tag: BsubsN3_010100018827
BsubsN3_010100018827 -65 5.3 CATATTAGCGAACTAAAGGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: hisZ
Ortholog function: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
Bacillus subtilis subsp. subtilis str. 168 BSU34930 -65 5.3 CATATTAGCGAACTAAAGGA
Bacillus amyloliquefaciens FZB42 RBAM_032140 -61 5.3 CATATTAGCGAACTAAAGGA
Bacillus pumilus SAFR-032 BPUM_3128 -62 5.3 CATATTAGCGAACTAAAGGA
Bacillus licheniformis DSM 13 BLi03738 -62 5.5 CATATTAGCGAACTAAAGTA
Anoxybacillus flavithermus WK1 Aflv_2537 -55 4.9 AACTTTACTTTGCTAATATA
-39 5.6 TATATTAGCGAACTAAAGTA
Geobacillus kaustophilus HTA426 GK3077 -42 5.4 CATATTAGCAAACTAAAGCA
Bacillus halodurans C-125 BH3584 -71 4.3 TCCTTTATCTTGTTAGTATA
-55 5.6 TATATTAGCGAACTAAAGTA
Bacillus clausii KSM-K16 ABC3050 -43 5.6 TGATTTAGCAAACTAAAGTA
Oceanobacillus iheyensis HTE831 OB0553 -66 4.8 AACTTTACTTAGATAAAGTG
Paenibacillus sp. JDR-2 Pjdr2_0159 -37 5.6 CACTTTAATATACTAAAGTA