Propagation of GanR regulog to Bacillus subtilis subsp. subtilis str. NCIB 3610

Reference regulog properties
Source regulog:	GanR - Bacillales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactan utilization
Effector:	Beta-galactosides
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus subtilis subsp. subtilis str. NCIB 3610
Orthologous TF(s)	BsubsN3_010100018442
Regulated genes	2

Built upon 8 sites [see more]

Predicted regulatory interactions in *Bacillus subtilis subsp. subtilis str. NCIB 3610*
	Locus tag	Position	Score	Sequence
Position: -109 Score: 5.9 Sequence: TTAGGTAAAAAAATTTACTCTA Locus tag: BsubsN3_010100018437
	BsubsN3_010100018437	-109	5.9	TTAGGTAAAAAAATTTACTCTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ganO
Ortholog function: Arabinogalactan oligomer ABC transporter, binding protein
Bacillus subtilis subsp. subtilis str. 168	BSU34160	-109	5.9	TTAGGTAAAAAAATTTACTCTA
Bacillus pumilus SAFR-032	BPUM_3613	-126	6.8	TTGAGTAAAAAATTTTACTTAA
Bacillus licheniformis DSM 13	BLi04280	-110	5.8	TTTCGTAAAACATTTTACCTGT
Bacillus halodurans C-125	BH2019	-127	5.9	TTTCCGAAAATATTTTACTCAT
Bacillus clausii KSM-K16	ABC3520	-108	7.2	TTAAGTAAAATATTTTACTAAA

Position: -54 Score: 6.6 Sequence: GAAAGTAAAATATTTTACTAAA Locus tag: BsubsN3_010100018442
	BsubsN3_010100018442	-54	6.6	GAAAGTAAAATATTTTACTAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ganR
Ortholog function: Transcriptional regulator of galactan utilization operon, LacI family
Bacillus subtilis subsp. subtilis str. 168	BSU34170	-54	6.6	GAAAGTAAAATATTTTACTAAA
Bacillus pumilus SAFR-032	BPUM_3612	-74	5.6	TTTAATAAAAATATTTACTAAT
Bacillus licheniformis DSM 13	BLi04281	-69	7	ATTAGTAAAATATTTTACTAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --