Propagation of YtrA regulog to Bacillus subtilis subsp. subtilis str. NCIB 3610
| Source regulog: | YtrA - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Ramoplanin resistance |
| Effector: | Ramoplanin |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus subtilis subsp. subtilis str. NCIB 3610 |
| Orthologous TF(s) | BsubsN3_010100016487 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -37
Score: 6.6 Sequence: TGTACTACATCAAATAATACA
Locus tag: BsubsN3_010100019647
|
||||
| BsubsN3_010100019647 | -37 | 6.6 | TGTACTACATCAAATAATACA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: ywoB | ||||
| Ortholog function: Putative integral inner membrane protein | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU36500 | -34 | 6.6 | TGTACTACATCAAATAATACA |