Propagation of BmrR regulog to Bacillus subtilis subsp. subtilis str. NCIB 3610

Reference regulog properties
Source regulog:	BmrR - Bacillales
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Multidrug resistance
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus subtilis subsp. subtilis str. NCIB 3610
Orthologous TF(s)	BsubsN3_010100013097
Regulated genes	1

Built upon 2 sites [see more]

Predicted regulatory interactions in *Bacillus subtilis subsp. subtilis str. NCIB 3610*
	Locus tag	Position	Score	Sequence
Position: -63 Score: 4.7 Sequence: GACTCTCCCCTAGGAGGAGGTCT Locus tag: BsubsN3_010100013092
	BsubsN3_010100013092	-63	4.7	GACTCTCCCCTAGGAGGAGGTCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: bmr
Ortholog function: Multidrug transporter (MFS family)
Bacillus subtilis subsp. subtilis str. 168	BSU24010	-63	4.7	GACTCTCCCCTAGGAGGAGGTCT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --