Propagation of BmrR regulog to Bacillus subtilis subsp. subtilis str. NCIB 3610
| Source regulog: | BmrR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus subtilis subsp. subtilis str. NCIB 3610 |
| Orthologous TF(s) | BsubsN3_010100013097 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -63
Score: 4.7 Sequence: GACTCTCCCCTAGGAGGAGGTCT
Locus tag: BsubsN3_010100013092
|
||||
| BsubsN3_010100013092 | -63 | 4.7 | GACTCTCCCCTAGGAGGAGGTCT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: bmr | ||||
| Ortholog function: Multidrug transporter (MFS family) | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU24010 | -63 | 4.7 | GACTCTCCCCTAGGAGGAGGTCT |